ID: 1166782601

View in Genome Browser
Species Human (GRCh38)
Location 19:45350319-45350341
Sequence CCTGCGGAGAAGGGAGTGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166782601_1166782609 16 Left 1166782601 19:45350319-45350341 CCAGACACTCCCTTCTCCGCAGG 0: 1
1: 0
2: 1
3: 14
4: 225
Right 1166782609 19:45350358-45350380 ACAGAACAAGTATCAACAAGCGG 0: 1
1: 0
2: 1
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166782601 Original CRISPR CCTGCGGAGAAGGGAGTGTC TGG (reversed) Exonic
900392548 1:2440026-2440048 CCTGTGGAGAAGGGGGAGTCAGG + Intronic
901026516 1:6281286-6281308 CCTGTGGAGAAGGGAGGGCGGGG + Exonic
901514581 1:9736389-9736411 CCAGCTGAGAAGGCAGTGGCTGG - Intronic
901844873 1:11975417-11975439 CCTGTGGGGAGGGGAGTGACAGG + Exonic
902278721 1:15358958-15358980 CGTGGGGGGAAGGGAGTCTCTGG + Intronic
902984070 1:20144715-20144737 CCCCCAGAGAAGGGAGTGGCTGG + Intronic
903015362 1:20358116-20358138 CCCGCAGAGAAGGGACTGGCTGG - Intergenic
903216662 1:21847285-21847307 CCTGGGGAGAAGGAACTTTCAGG - Intronic
903269412 1:22178268-22178290 CCTGTGGAGGAGGGAGTCCCTGG - Intergenic
904008121 1:27374364-27374386 CCTGGGGAGAAGGGAGCCCCAGG - Exonic
904255990 1:29255182-29255204 CCTGGGTAGAAGGGAGAGTGGGG + Intronic
904793283 1:33039794-33039816 CTTGCCTTGAAGGGAGTGTCTGG - Intronic
905923234 1:41732803-41732825 CCTCTGGAGAAGAGAGTCTCTGG - Intronic
906283441 1:44569694-44569716 CCTGCTGAGAAGCCAGGGTCTGG + Intronic
907325046 1:53632283-53632305 ACTGAGGAGAAGGGAGAGTAAGG + Intronic
907717540 1:56941137-56941159 CCTGTGGACAAGGAAGTGTCTGG - Intronic
911749735 1:101482395-101482417 CTTGCTGTGTAGGGAGTGTCTGG - Intergenic
912517624 1:110226152-110226174 CCTGCGCCGATGGTAGTGTCCGG + Exonic
912861500 1:113217876-113217898 CTTGCCGTGTAGGGAGTGTCTGG - Intergenic
917095158 1:171392481-171392503 ACTGTAGAGAAGGAAGTGTCTGG + Intergenic
919915352 1:202135526-202135548 CCTACGGAGAAGGGAGGGTGAGG + Exonic
923091029 1:230741449-230741471 CCTGTGGAGCAGCGAGTGTGGGG + Intergenic
924481512 1:244439542-244439564 CTTGAGGAGAAGGAAGAGTCAGG - Intronic
1063064576 10:2595144-2595166 CCTGCGGCCAAGGCTGTGTCAGG + Intergenic
1065223935 10:23523813-23523835 CAAGAGGAGAAGGGAGTGGCTGG - Intergenic
1069073494 10:64014225-64014247 CCTGAGGAGAAGAGATTATCTGG - Intergenic
1072914321 10:99527682-99527704 CCTGCGGAGATGTGGGGGTCGGG - Intergenic
1076236599 10:128868361-128868383 CCAGAGGAGAATGGAGTGGCTGG + Intergenic
1076670822 10:132120308-132120330 CCTGCGGGGGAGGGATTGGCTGG + Intronic
1076764433 10:132625290-132625312 CCTGCTGAGAAAGGGGTGTGGGG - Intronic
1076809954 10:132881325-132881347 CTTGCGGTGCAGGGAATGTCTGG - Intronic
1077155903 11:1090676-1090698 CCTGCAGAGAAGGGCCTGCCAGG + Intergenic
1077296168 11:1827210-1827232 CCTGGAGAGCAGGGGGTGTCGGG - Intergenic
1079341618 11:19616501-19616523 CCCGCGGAGCAGGGAGAGTTGGG + Intronic
1083224487 11:61276291-61276313 CCTCCGGAGTAGGGAGTAGCTGG - Intronic
1083539739 11:63504307-63504329 ACTCAGTAGAAGGGAGTGTCTGG - Intergenic
1083747084 11:64742675-64742697 GCTGCGGAGCAGGGTGGGTCCGG + Intronic
1084003849 11:66313218-66313240 CCTGCAGAGACGGGATGGTCTGG - Intergenic
1084162385 11:67356795-67356817 CCAGGGGAAGAGGGAGTGTCTGG - Intronic
1084198375 11:67539353-67539375 CCTGCAGGGCAGGGAGTGTGAGG - Intergenic
1084686268 11:70697774-70697796 CCTGCAGAGGTGGGAGGGTCCGG - Intronic
1088180347 11:107102926-107102948 CATGGGGAGTAGGGAGTGGCAGG - Intergenic
1088418119 11:109612273-109612295 CTTTGGGAGAAAGGAGTGTCTGG + Intergenic
1088921614 11:114263387-114263409 CTTGCCCAGAAGGGAGTGTCTGG - Intronic
1089588851 11:119527256-119527278 CCTGGGGAGAAGGGAGCTGCAGG + Intergenic
1095981847 12:47978613-47978635 CCTGGCGAGAAGGGAGAGCCTGG - Exonic
1096657009 12:53098111-53098133 CCTGGGGAGACGGGAGTGGGTGG + Intronic
1102259660 12:111436374-111436396 ACTGCGGGGTAGGGAGTGTAGGG + Intronic
1102389045 12:112534992-112535014 CGTGGGGTGAAGGGAGTGTTGGG + Intergenic
1102678457 12:114674220-114674242 GCTGCGGCGCAGGGACTGTCCGG - Exonic
1102698026 12:114815293-114815315 CCTGCTGAGAAGGGACTTTGAGG - Intergenic
1103212738 12:119178726-119178748 CCAGGGGAGGAGAGAGTGTCCGG + Exonic
1103432724 12:120902956-120902978 TATCCGGAGAAGGGAGTGCCAGG - Intronic
1103997698 12:124840834-124840856 TGTCTGGAGAAGGGAGTGTCGGG - Intronic
1104940374 12:132392183-132392205 CCTGGGGAGAACGGGGTGGCCGG - Intergenic
1105418177 13:20231382-20231404 CCTGGGGAGCAGGAAGGGTCAGG - Exonic
1106375970 13:29188663-29188685 CCAGCAGAGCAGGGAGTCTCTGG - Intronic
1108279559 13:48847978-48848000 ACTGCAGAGAAGGGACTGGCTGG + Intergenic
1110872064 13:80463843-80463865 CCTGCCAAGAAGGGAGTGGGAGG + Intergenic
1113424556 13:110197388-110197410 TCAGCGGGGAAGGGAGTGCCTGG - Intronic
1113491169 13:110693224-110693246 CGTGCAGAGAAGGGAGTATTGGG - Intronic
1113847265 13:113399477-113399499 CCTGGGCAGGAGGGAGGGTCTGG - Intergenic
1117328937 14:54693844-54693866 CCTGGGAATAAGGGAGTGTAAGG + Intronic
1118780381 14:69003890-69003912 TCTGCGGGGAAGGGTGTTTCAGG - Intergenic
1119738552 14:76999391-76999413 CCTGAGGAGAAGCCAATGTCTGG + Intergenic
1121633530 14:95438722-95438744 CCTGCAGGGAAGAGAGTGTCGGG - Intronic
1122032105 14:98919698-98919720 CCTGCGGAGTGGGGAGGGGCAGG + Intergenic
1122220787 14:100238407-100238429 CCTGAGGAGAAGGGAGGGAGGGG - Intronic
1122984466 14:105205820-105205842 CCAGTGGGGAGGGGAGTGTCTGG + Intergenic
1123162260 14:106289648-106289670 GCTGAGGAGAAGGCAGTGCCCGG + Intergenic
1123942414 15:25223001-25223023 CATGCGGAGAAGGGGGTGTTGGG - Intergenic
1123944088 15:25230612-25230634 CATGTGGAGAAGGGGGTGGCGGG - Intergenic
1123946528 15:25241501-25241523 CACGCGGAGAAGGGGGTGGCTGG - Intergenic
1124073654 15:26421025-26421047 CCAGAGAAGAAGGGAGTCTCTGG + Intergenic
1124624798 15:31301618-31301640 CCTGCCGAGAAGTGAGTGCAGGG + Intergenic
1125040675 15:35183288-35183310 CCTGCTGAGAAGGAAATGTAGGG - Intergenic
1126053927 15:44711857-44711879 CCTACGGCGACGGGAGGGTCGGG + Intronic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1130195643 15:81778129-81778151 CATGGGGAGAATGGAGTGCCAGG + Intergenic
1130867439 15:87944778-87944800 CCTGGGGAGAAGAGTGTATCTGG + Intronic
1131025532 15:89138114-89138136 CCTGTGGAGCAGGGAGGCTCTGG + Intronic
1132462753 16:63490-63512 CCTGAGCAGAAGGGACTCTCTGG - Intronic
1132497940 16:272695-272717 CCTGGGGAACAGGGAGTGACCGG + Intronic
1133337332 16:5014669-5014691 TCTGGGGAGATGGGAGTGTGGGG + Intronic
1135475744 16:22772945-22772967 CCTGCAGGGAAGAGAGTGTGTGG + Intergenic
1135594096 16:23728137-23728159 CCCACGGAGAAGGGAGAGTGGGG + Intergenic
1136372695 16:29846136-29846158 GCTGGGGAGAAGGCAGAGTCAGG - Exonic
1136543508 16:30942353-30942375 CCTGCGGAGAGGGGGCAGTCAGG - Exonic
1137633119 16:49962050-49962072 CCTGCAGAGAAGGGAATGCAGGG - Intergenic
1141735586 16:85850295-85850317 ACCGAGGAGGAGGGAGTGTCAGG - Intergenic
1144734269 17:17546244-17546266 CCTGTGGAGAAGGGCATGTGTGG + Intronic
1145001077 17:19304990-19305012 CCTGTGGAGAAGGCAGGGTGAGG - Intronic
1147742269 17:42676110-42676132 CCAGCGGGGAAGGGAGAGGCAGG + Intronic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1151937854 17:77274276-77274298 CCTGCCAAGAATGGAGGGTCTGG - Intergenic
1153518599 18:5930009-5930031 GCTGGGGAGGAGGGAGTGGCAGG + Intergenic
1157572420 18:48721765-48721787 CCTGCACAGGAGTGAGTGTCAGG - Intronic
1162740878 19:12772912-12772934 CCTGGGGAGAAGGGGGTGTCAGG + Exonic
1163493162 19:17629165-17629187 CCTGGGGAGAAGGGAGTCCTGGG + Intronic
1165144774 19:33724239-33724261 CCTGTGGGGCAGGGTGTGTCAGG - Intronic
1165436165 19:35796778-35796800 CCTGCGGAGAGGTGAGGGCCTGG - Intergenic
1166713467 19:44951659-44951681 CCTGAGGAGAAGGGACTGGGGGG - Intronic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
1166895252 19:46018534-46018556 CCTGGGGAGAGGGCAGGGTCAGG - Exonic
1168056077 19:53866133-53866155 CCTACGGAGCAGGGAGGGGCCGG - Intergenic
1168708440 19:58482850-58482872 CCAGCCCAGAAGGGAGAGTCAGG + Intronic
925984746 2:9206758-9206780 CCCGCGGAGAGGGGCGGGTCCGG - Exonic
927946048 2:27135835-27135857 CCGAGGGAGAATGGAGTGTCAGG - Intergenic
928179053 2:29054796-29054818 CCTGCCCTGGAGGGAGTGTCTGG + Exonic
928404284 2:31002733-31002755 CCTGCAGAGAATGGATGGTCTGG + Intronic
930016510 2:46974536-46974558 CTTGCTGTGTAGGGAGTGTCTGG + Intronic
931225754 2:60328472-60328494 GCTGCGGAGAAGGGAGTCAGTGG + Intergenic
931816593 2:65909303-65909325 GCAGAGGAGAAGGGAGTTTCAGG + Intergenic
932782338 2:74568399-74568421 CCTCTGGAGAAGGAAGAGTCCGG + Intronic
933988973 2:87619917-87619939 CCTTGGGAGATGGGGGTGTCTGG + Intergenic
934500582 2:94857602-94857624 CCTGAGGAGGAGGGCCTGTCTGG + Intergenic
936163536 2:110102121-110102143 CCTGAGGAGAAAGGAGGGTATGG - Intronic
936304870 2:111330909-111330931 CCTTGGGAGATGGGGGTGTCTGG - Intergenic
938086932 2:128407812-128407834 CCTGCAGGGGAGGGAGTGTGTGG + Intergenic
938626014 2:133110457-133110479 ACTGGGGAGGAGGGAGAGTCAGG + Intronic
939121578 2:138123897-138123919 TGTGGGGAGAAGGGAGTATCAGG + Intergenic
941791334 2:169555326-169555348 CCAGCACAGAACGGAGTGTCTGG - Intronic
943529237 2:189058454-189058476 CCTGGTGAGAAGGGAATGGCTGG - Exonic
947144742 2:227054629-227054651 CCTGGAGAGAAGGGCATGTCTGG - Exonic
947610010 2:231518929-231518951 CCTGGGGAGAAGGGTCTGACTGG - Intergenic
948092234 2:235303910-235303932 CCTGGGGAGAAGGTGGCGTCCGG - Intergenic
948393799 2:237630381-237630403 CCTGGGGAGACTGGAGAGTCAGG + Intronic
948985477 2:241520028-241520050 CCTGGGGAGAAGTGAGTATGTGG - Intergenic
1172095119 20:32456757-32456779 GCTGGGGAGAAGGGAGAGCCTGG - Intronic
1173846924 20:46194087-46194109 CCTGAGGAGCAGGGAGAGACTGG - Intronic
1177175004 21:17693776-17693798 CCCACAGAAAAGGGAGTGTCAGG + Intergenic
1179438000 21:41375190-41375212 CCAGGTGACAAGGGAGTGTCTGG - Intronic
1180049670 21:45325438-45325460 CCTGCAGATAAGGGGGTGTGCGG - Intergenic
1181050997 22:20238221-20238243 CCTGCGGGGATGTGAGTGTGAGG + Intergenic
1182416606 22:30225328-30225350 TTTGCTGAGAAGGAAGTGTCCGG + Intergenic
1183023352 22:35044950-35044972 CCTCTGGAAAAGGGAGTTTCTGG + Intergenic
1183186080 22:36292375-36292397 CCTGTGGAGAGGGAAGTGACTGG - Intronic
1183338494 22:37264872-37264894 CATGAGGAGAAGGCAGTGTTTGG - Intergenic
1183672011 22:39278501-39278523 CCTCCGCAGAAGGGAGTGCTGGG - Intergenic
1184090655 22:42291360-42291382 CCTGAGGAGAGGGCAGTGTGTGG + Intronic
1184315276 22:43683014-43683036 CCTGCCGTGGAGGGAGTGTCTGG - Intronic
1184942107 22:47776571-47776593 CCTGCTGAGAAGTGAGTCTCTGG - Intergenic
1185278828 22:49961296-49961318 CCTGCGGAGACGCGGGGGTCAGG - Exonic
949394745 3:3602759-3602781 CCTGTGGAGGAAGGAGTGGCAGG + Intergenic
950370192 3:12522881-12522903 GCTGCTGAGTAGGGAGTGTAAGG - Intronic
950674002 3:14543813-14543835 CCTGGGGACATGGAAGTGTCAGG - Intergenic
950798491 3:15530650-15530672 GCTGGGGAGAAGGAGGTGTCAGG - Intergenic
953999414 3:47544044-47544066 CCTGAGTGGGAGGGAGTGTCGGG + Intergenic
954217606 3:49133152-49133174 CCTGGGGCGAAGGCAGTTTCCGG - Intergenic
954908785 3:54085974-54085996 CCTGGGGTGAAGGAAGTTTCCGG - Intergenic
957522434 3:81336842-81336864 CCAATGGGGAAGGGAGTGTCAGG + Intergenic
957994877 3:87676792-87676814 GCTGGGAATAAGGGAGTGTCAGG - Intergenic
960996993 3:123346784-123346806 CCTGGGGAGAAGGAACTCTCCGG + Intronic
961219267 3:125187141-125187163 CCTGGGGAGAAGCGAGGGTGGGG - Intronic
961453501 3:127013254-127013276 CCTGGTGAGAAGGGAGGGTGGGG - Intronic
961467216 3:127089241-127089263 CCCGCGGTGAAGGGAGGGTTGGG + Intergenic
961578627 3:127859319-127859341 TCTGGGGAGGAGGGAGTGTAAGG + Intergenic
962090364 3:132238263-132238285 CATGCAGAGAAGGGAATTTCGGG - Intronic
962386312 3:134935301-134935323 CAGGCGAAGAAGGGAGGGTCAGG + Intronic
966732546 3:183162831-183162853 CCTACGGAGCAGGGAGGGGCGGG + Exonic
968470997 4:782203-782225 CCTGGGGAGGAGGCCGTGTCTGG + Intergenic
969079304 4:4606202-4606224 AGTGGGGAGAAGGGAGTCTCTGG + Intergenic
969268451 4:6081559-6081581 CAGACAGAGAAGGGAGTGTCAGG + Intronic
969695949 4:8734993-8735015 CCTGGGGAGAATGGGGTCTCTGG - Intergenic
971143064 4:23946003-23946025 CCTGGGGAGGAGGGAGGGTCCGG - Intergenic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
976879844 4:89907010-89907032 ACTGTGGAGGAGGGAGTGTGGGG - Intronic
985178030 4:187224145-187224167 CCTGGGGAGATGGTAGTGACTGG - Intergenic
985621928 5:960345-960367 CCTGCTGAGAAGGGGTTGCCAGG - Intergenic
986680685 5:10230784-10230806 CCTGGGGAGGAGGAAGTGCCAGG - Intronic
990983300 5:61620343-61620365 CTAGCTGAGAAGGGAGTGTAAGG + Intergenic
992121005 5:73592113-73592135 GATGCTGAGAAGGGTGTGTCAGG - Intergenic
992382856 5:76255800-76255822 GCTGCGGAGATGAGAGTCTCAGG - Intronic
995851563 5:116551624-116551646 CCTGCAGAGAAGCCAGTGCCTGG - Intronic
997641595 5:135452158-135452180 CATGGGGAGAAGGGAGGGCCTGG - Intronic
997690611 5:135825452-135825474 CCTGCTGGGAGGGGTGTGTCTGG - Intergenic
998213589 5:140220244-140220266 CCTGAGGGCAAGGGACTGTCAGG + Intronic
1001412352 5:171520305-171520327 CCTGGGGAGATGGGAGTTTGTGG + Intergenic
1001535286 5:172493717-172493739 CCTGCTGACCAGGGAGTCTCTGG + Intergenic
1002350904 5:178582957-178582979 CCTGGGAAGAAGGGAGTGAAAGG - Intronic
1004516615 6:16326944-16326966 CCTGCGTAGAAGGCCGTGGCTGG + Exonic
1005923159 6:30418327-30418349 CCTGTGGAGCAGGGGGTTTCTGG - Intergenic
1005945558 6:30592801-30592823 GTTGGGGAGAAGGGAGTGACAGG + Intronic
1006224190 6:32522339-32522361 CCTGAGGCGAACGGGGTGTCTGG + Intronic
1006521877 6:34575531-34575553 CCTGCTGAGTAGGGAGAGTGGGG + Intergenic
1006788780 6:36685337-36685359 TCTGCAGGGATGGGAGTGTCCGG + Intronic
1007410000 6:41656018-41656040 CCTGCGGAGCAGGGAGGGCCAGG - Intergenic
1007636682 6:43303925-43303947 TATGGGGAGAAGGGAGTATCAGG + Intronic
1007779715 6:44246019-44246041 CCTGGGAAGGAGGGAGTCTCTGG - Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1017153305 6:151300582-151300604 CCTGTGGAGAAGGAAGTGGATGG + Intronic
1017160716 6:151363097-151363119 CCTGGGGAGACAGGAGTGACCGG - Intergenic
1017630379 6:156391183-156391205 CCTGCTGAGAAGCGTGTGCCTGG - Intergenic
1017728719 6:157295548-157295570 GCTGCTGAGAAGGGAGAGGCTGG + Intronic
1017975445 6:159353088-159353110 TCTGGGGAGAAGGGACTTTCTGG - Intergenic
1019911951 7:4106149-4106171 CCTTCTGAGCAGCGAGTGTCTGG - Intronic
1020432161 7:8125526-8125548 CCTGGGGATAATGGAGTGTTGGG - Intronic
1022113928 7:27246794-27246816 CCCGGTGAGAAGGGAGTGTGAGG - Intronic
1023294713 7:38702626-38702648 CCTGCAGAGACGGGAGTGAGAGG - Intergenic
1029888133 7:103895441-103895463 TCTGGTGAGAAGGGAGTGTCCGG + Intronic
1030679975 7:112424356-112424378 CTTGCTGTGTAGGGAGTGTCTGG + Intronic
1031103167 7:117507241-117507263 CCTGAGGAGAAGGCAAGGTCGGG - Intronic
1031450763 7:121915193-121915215 CCTCCTGATCAGGGAGTGTCTGG - Intronic
1034990772 7:155546859-155546881 CCTGGGGAGAAGGGATTTTAGGG - Intergenic
1035061204 7:156070899-156070921 CCAGAGGTGAAGGGAGTCTCTGG - Intergenic
1035375133 7:158402668-158402690 CCTGCAGGGAAGGGAAGGTCTGG + Intronic
1035914894 8:3608235-3608257 CCTGCAGAGGAGGTAGTGTCAGG + Intronic
1036183704 8:6606532-6606554 CCTGTCGACCAGGGAGTGTCAGG + Intronic
1036795277 8:11751463-11751485 CCTGGGGAGAAGGGATTGGAAGG + Intronic
1039421932 8:37450566-37450588 GCTGGGAAGAAGGGAGAGTCAGG + Intergenic
1042978530 8:74499455-74499477 CCTGCTTAGAAAGGAGTGTTTGG + Intergenic
1048011273 8:130458162-130458184 CCTGCAGAAAGGGGACTGTCTGG - Intergenic
1048059065 8:130898866-130898888 CCTGTGAAGAATGGACTGTCGGG - Intronic
1048234472 8:132675944-132675966 ACTGAGGAGAAGGAAGTGTAAGG - Intergenic
1048831080 8:138478158-138478180 CCTGAGATGCAGGGAGTGTCAGG - Intronic
1049175314 8:141189161-141189183 GCTGGGGAGAAGGGACTGTTTGG + Intronic
1051330710 9:16022454-16022476 CCTATGGAGAGGGGAGTGACTGG + Intronic
1052824890 9:33167358-33167380 CCGGCGGAGAGGGGAGGGGCGGG + Intergenic
1053462299 9:38280390-38280412 CCTGGGAAGAAGGGAGTCTCAGG - Intergenic
1058618782 9:106862473-106862495 CCTGCGGAGAAGGCGGTGCGAGG - Intergenic
1058923517 9:109640462-109640484 CCTGGGGAGAAGGGTGGGTGGGG - Intergenic
1060400741 9:123348289-123348311 GCTGCAGAGCAGGGAGTGACAGG - Intergenic
1060468076 9:123925361-123925383 TCTGGGGAGGAGGGAGGGTCAGG - Intronic
1061108677 9:128552140-128552162 ACTGCGGAGAAGGGCGGGGCGGG - Intergenic
1062131666 9:134898000-134898022 CCTGCCAAGAATGGAGTTTCAGG + Intergenic
1062312230 9:135945039-135945061 CCGGAGGAAAAGGGAGTTTCGGG - Exonic
1062346578 9:136118041-136118063 CCTGCGGGCACGGGAGGGTCAGG - Intronic
1062382144 9:136291645-136291667 CCTGCAAAGACAGGAGTGTCAGG + Exonic
1062522603 9:136964454-136964476 TCTGCCGAGCAGGGAGTGGCAGG - Intergenic
1062543329 9:137051129-137051151 ACTGTGGAGAGGGGAGTGTGGGG + Exonic
1187473269 X:19588216-19588238 CCTGCAGAGCAGTGAGGGTCAGG + Intronic
1188132145 X:26449363-26449385 CTTCAGGAGAAGTGAGTGTCTGG - Intergenic
1189381724 X:40506950-40506972 CCTGGGGAGAGGGGAGTGTGGGG + Intergenic
1192168863 X:68842343-68842365 CCTGGGGTGAGGGGAGTGGCAGG - Intergenic
1195651567 X:107290362-107290384 CCTGGTGTGATGGGAGTGTCAGG + Intergenic
1196871689 X:120118388-120118410 CTTGCTGTGTAGGGAGTGTCTGG + Intergenic
1199016229 X:142819473-142819495 CCTGGGGAGCAGGGAGAGACAGG + Intergenic
1199711057 X:150469928-150469950 CCTGCGGCTATGGGAGTGGCTGG + Exonic
1199759251 X:150892703-150892725 TCTGCTCAGAAGGGAGTGTTGGG - Intronic
1200841140 Y:7782928-7782950 CCTGTGGAGAGGAGAGTGTGTGG - Intergenic