ID: 1166782835

View in Genome Browser
Species Human (GRCh38)
Location 19:45351321-45351343
Sequence GGTCCTGGGTGCTGGCGCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 1, 2: 6, 3: 51, 4: 444}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166782835_1166782846 25 Left 1166782835 19:45351321-45351343 CCTCAGCGCCAGCACCCAGGACC 0: 1
1: 1
2: 6
3: 51
4: 444
Right 1166782846 19:45351369-45351391 CTGCGCTGGCCGCAGCTTCTTGG 0: 1
1: 0
2: 0
3: 16
4: 148
1166782835_1166782847 26 Left 1166782835 19:45351321-45351343 CCTCAGCGCCAGCACCCAGGACC 0: 1
1: 1
2: 6
3: 51
4: 444
Right 1166782847 19:45351370-45351392 TGCGCTGGCCGCAGCTTCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1166782835_1166782844 11 Left 1166782835 19:45351321-45351343 CCTCAGCGCCAGCACCCAGGACC 0: 1
1: 1
2: 6
3: 51
4: 444
Right 1166782844 19:45351355-45351377 TAACGTCCAGTGAACTGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166782835 Original CRISPR GGTCCTGGGTGCTGGCGCTG AGG (reversed) Exonic