ID: 1166783047

View in Genome Browser
Species Human (GRCh38)
Location 19:45352233-45352255
Sequence AGGTGGCCAAGTACTTCCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166783047_1166783058 21 Left 1166783047 19:45352233-45352255 CCGCAGGAAGTACTTGGCCACCT 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1166783058 19:45352277-45352299 GGTTGAGGTTGGCATCTGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 211
1166783047_1166783059 30 Left 1166783047 19:45352233-45352255 CCGCAGGAAGTACTTGGCCACCT 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1166783047_1166783055 6 Left 1166783047 19:45352233-45352255 CCGCAGGAAGTACTTGGCCACCT 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1166783055 19:45352262-45352284 CCTCGTCCACGGTCAGGTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 43
1166783047_1166783052 0 Left 1166783047 19:45352233-45352255 CCGCAGGAAGTACTTGGCCACCT 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1166783052 19:45352256-45352278 GGACACCCTCGTCCACGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1166783047_1166783050 -5 Left 1166783047 19:45352233-45352255 CCGCAGGAAGTACTTGGCCACCT 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1166783050 19:45352251-45352273 CACCTGGACACCCTCGTCCACGG 0: 1
1: 0
2: 0
3: 9
4: 115
1166783047_1166783056 10 Left 1166783047 19:45352233-45352255 CCGCAGGAAGTACTTGGCCACCT 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1166783056 19:45352266-45352288 GTCCACGGTCAGGTTGAGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166783047 Original CRISPR AGGTGGCCAAGTACTTCCTG CGG (reversed) Exonic