ID: 1166783051

View in Genome Browser
Species Human (GRCh38)
Location 19:45352253-45352275
Sequence GACCGTGGACGAGGGTGTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166783051_1166783060 19 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783060 19:45352295-45352317 TGAGGTGCTCCTGGATCCAGCGG 0: 1
1: 0
2: 5
3: 20
4: 189
1166783051_1166783059 10 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1166783051_1166783062 21 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783062 19:45352297-45352319 AGGTGCTCCTGGATCCAGCGGGG 0: 1
1: 0
2: 2
3: 8
4: 151
1166783051_1166783058 1 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783058 19:45352277-45352299 GGTTGAGGTTGGCATCTGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 211
1166783051_1166783061 20 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783061 19:45352296-45352318 GAGGTGCTCCTGGATCCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 225
1166783051_1166783056 -10 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783056 19:45352266-45352288 GTCCACGGTCAGGTTGAGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166783051 Original CRISPR GACCGTGGACGAGGGTGTCC AGG (reversed) Exonic