ID: 1166783054

View in Genome Browser
Species Human (GRCh38)
Location 19:45352262-45352284
Sequence CCTCAACCTGACCGTGGACG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166783054_1166783058 -8 Left 1166783054 19:45352262-45352284 CCTCGTCCACGGTCAGGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1166783058 19:45352277-45352299 GGTTGAGGTTGGCATCTGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 211
1166783054_1166783062 12 Left 1166783054 19:45352262-45352284 CCTCGTCCACGGTCAGGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1166783062 19:45352297-45352319 AGGTGCTCCTGGATCCAGCGGGG 0: 1
1: 0
2: 2
3: 8
4: 151
1166783054_1166783060 10 Left 1166783054 19:45352262-45352284 CCTCGTCCACGGTCAGGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1166783060 19:45352295-45352317 TGAGGTGCTCCTGGATCCAGCGG 0: 1
1: 0
2: 5
3: 20
4: 189
1166783054_1166783059 1 Left 1166783054 19:45352262-45352284 CCTCGTCCACGGTCAGGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1166783054_1166783061 11 Left 1166783054 19:45352262-45352284 CCTCGTCCACGGTCAGGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1166783061 19:45352296-45352318 GAGGTGCTCCTGGATCCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166783054 Original CRISPR CCTCAACCTGACCGTGGACG AGG (reversed) Exonic