ID: 1166783056

View in Genome Browser
Species Human (GRCh38)
Location 19:45352266-45352288
Sequence GTCCACGGTCAGGTTGAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166783049_1166783056 -7 Left 1166783049 19:45352250-45352272 CCACCTGGACACCCTCGTCCACG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1166783056 19:45352266-45352288 GTCCACGGTCAGGTTGAGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1166783047_1166783056 10 Left 1166783047 19:45352233-45352255 CCGCAGGAAGTACTTGGCCACCT 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1166783056 19:45352266-45352288 GTCCACGGTCAGGTTGAGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1166783045_1166783056 17 Left 1166783045 19:45352226-45352248 CCATCTGCCGCAGGAAGTACTTG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1166783056 19:45352266-45352288 GTCCACGGTCAGGTTGAGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1166783051_1166783056 -10 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783056 19:45352266-45352288 GTCCACGGTCAGGTTGAGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166783056 Original CRISPR GTCCACGGTCAGGTTGAGGT TGG Exonic