ID: 1166783057

View in Genome Browser
Species Human (GRCh38)
Location 19:45352268-45352290
Sequence TGCCAACCTCAACCTGACCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166783057_1166783059 -5 Left 1166783057 19:45352268-45352290 CCACGGTCAGGTTGAGGTTGGCA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1166783057_1166783062 6 Left 1166783057 19:45352268-45352290 CCACGGTCAGGTTGAGGTTGGCA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1166783062 19:45352297-45352319 AGGTGCTCCTGGATCCAGCGGGG 0: 1
1: 0
2: 2
3: 8
4: 151
1166783057_1166783061 5 Left 1166783057 19:45352268-45352290 CCACGGTCAGGTTGAGGTTGGCA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1166783061 19:45352296-45352318 GAGGTGCTCCTGGATCCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 225
1166783057_1166783060 4 Left 1166783057 19:45352268-45352290 CCACGGTCAGGTTGAGGTTGGCA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1166783060 19:45352295-45352317 TGAGGTGCTCCTGGATCCAGCGG 0: 1
1: 0
2: 5
3: 20
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166783057 Original CRISPR TGCCAACCTCAACCTGACCG TGG (reversed) Exonic