ID: 1166783058

View in Genome Browser
Species Human (GRCh38)
Location 19:45352277-45352299
Sequence GGTTGAGGTTGGCATCTGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166783054_1166783058 -8 Left 1166783054 19:45352262-45352284 CCTCGTCCACGGTCAGGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1166783058 19:45352277-45352299 GGTTGAGGTTGGCATCTGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 211
1166783047_1166783058 21 Left 1166783047 19:45352233-45352255 CCGCAGGAAGTACTTGGCCACCT 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1166783058 19:45352277-45352299 GGTTGAGGTTGGCATCTGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 211
1166783051_1166783058 1 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783058 19:45352277-45352299 GGTTGAGGTTGGCATCTGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 211
1166783045_1166783058 28 Left 1166783045 19:45352226-45352248 CCATCTGCCGCAGGAAGTACTTG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1166783058 19:45352277-45352299 GGTTGAGGTTGGCATCTGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 211
1166783049_1166783058 4 Left 1166783049 19:45352250-45352272 CCACCTGGACACCCTCGTCCACG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1166783058 19:45352277-45352299 GGTTGAGGTTGGCATCTGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 211
1166783053_1166783058 -7 Left 1166783053 19:45352261-45352283 CCCTCGTCCACGGTCAGGTTGAG 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1166783058 19:45352277-45352299 GGTTGAGGTTGGCATCTGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166783058 Original CRISPR GGTTGAGGTTGGCATCTGTG AGG Exonic