ID: 1166783059

View in Genome Browser
Species Human (GRCh38)
Location 19:45352286-45352308
Sequence TGGCATCTGTGAGGTGCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166783057_1166783059 -5 Left 1166783057 19:45352268-45352290 CCACGGTCAGGTTGAGGTTGGCA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1166783054_1166783059 1 Left 1166783054 19:45352262-45352284 CCTCGTCCACGGTCAGGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1166783047_1166783059 30 Left 1166783047 19:45352233-45352255 CCGCAGGAAGTACTTGGCCACCT 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1166783053_1166783059 2 Left 1166783053 19:45352261-45352283 CCCTCGTCCACGGTCAGGTTGAG 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1166783049_1166783059 13 Left 1166783049 19:45352250-45352272 CCACCTGGACACCCTCGTCCACG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1166783051_1166783059 10 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783059 19:45352286-45352308 TGGCATCTGTGAGGTGCTCCTGG 0: 1
1: 0
2: 3
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166783059 Original CRISPR TGGCATCTGTGAGGTGCTCC TGG Exonic