ID: 1166783061

View in Genome Browser
Species Human (GRCh38)
Location 19:45352296-45352318
Sequence GAGGTGCTCCTGGATCCAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166783049_1166783061 23 Left 1166783049 19:45352250-45352272 CCACCTGGACACCCTCGTCCACG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1166783061 19:45352296-45352318 GAGGTGCTCCTGGATCCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 225
1166783053_1166783061 12 Left 1166783053 19:45352261-45352283 CCCTCGTCCACGGTCAGGTTGAG 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1166783061 19:45352296-45352318 GAGGTGCTCCTGGATCCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 225
1166783054_1166783061 11 Left 1166783054 19:45352262-45352284 CCTCGTCCACGGTCAGGTTGAGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1166783061 19:45352296-45352318 GAGGTGCTCCTGGATCCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 225
1166783051_1166783061 20 Left 1166783051 19:45352253-45352275 CCTGGACACCCTCGTCCACGGTC 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1166783061 19:45352296-45352318 GAGGTGCTCCTGGATCCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 225
1166783057_1166783061 5 Left 1166783057 19:45352268-45352290 CCACGGTCAGGTTGAGGTTGGCA 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1166783061 19:45352296-45352318 GAGGTGCTCCTGGATCCAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166783061 Original CRISPR GAGGTGCTCCTGGATCCAGC GGG Exonic