ID: 1166786139

View in Genome Browser
Species Human (GRCh38)
Location 19:45368471-45368493
Sequence GGTCAAATTCTCATTCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166786139_1166786144 30 Left 1166786139 19:45368471-45368493 CCACGATGAATGAGAATTTGACC 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1166786144 19:45368524-45368546 GCATGCCTTTGCAAGAGATATGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166786139 Original CRISPR GGTCAAATTCTCATTCATCG TGG (reversed) Intronic
902180821 1:14687077-14687099 GGTCAATTTTTCATTCAGAGGGG - Intronic
912115644 1:106403720-106403742 GGCTAAATTCTCATTCTTTGAGG - Intergenic
912898560 1:113621544-113621566 GGACATATTTTCATTCATCTTGG - Intronic
916501789 1:165393593-165393615 TGGCAAATTTTCATTCATAGAGG + Intergenic
924462672 1:244273179-244273201 AGCCAATTTCTCAATCATCGAGG + Intergenic
1068785275 10:60965923-60965945 AATCAAATTCTAACTCATCGGGG + Intronic
1072176845 10:92933537-92933559 GATCAAATTTTCATACATCTGGG - Intronic
1072962810 10:99944661-99944683 GGTCAATCACTCATTCATCCAGG - Intronic
1076574945 10:131458456-131458478 GGTCAGACTCTCATACATTGTGG - Intergenic
1076814779 10:132909406-132909428 GGTCATCTTCTCATACAACGAGG + Intronic
1080661767 11:34302411-34302433 GGTCAGATTCAAATTCATCAAGG + Intronic
1088569713 11:111211686-111211708 TGTCAAATTCTCTTTTATTGTGG - Intergenic
1090110340 11:123901068-123901090 GGACAATTTCTCATTCATTAGGG - Intergenic
1093641240 12:21528888-21528910 GGTCAAAATCTATTTCATAGAGG + Intronic
1096243862 12:49973720-49973742 GGTCAAAGTCTCAGTCCTCTGGG - Intronic
1108920874 13:55672765-55672787 GGTGAAAGTCTCAGTCATTGAGG + Intergenic
1110587232 13:77207974-77207996 AGTCAAATACTCATTCATCTGGG - Intronic
1114057069 14:18979858-18979880 GGTGAAATACTCATAAATCGAGG - Intronic
1114105477 14:19421888-19421910 GGTGAAATACTCATAAATCGAGG + Intronic
1116055517 14:39859504-39859526 GGTCAGATTCTCATGCAGCAGGG + Intergenic
1118749977 14:68798635-68798657 GGCCAAATTCTCATTTCTCTAGG + Intergenic
1202936039 14_KI270725v1_random:88455-88477 GGAAAAATTCTCATTCTTGGAGG + Intergenic
1126318240 15:47393715-47393737 GGTCAAATTCTCATGCAGAAGGG + Intronic
1126653193 15:50947455-50947477 GTTCAAAATCTCAGTCATCAAGG - Intronic
1130154207 15:81335694-81335716 GGTCCCATTCTCATTCATGTAGG + Intronic
1133963462 16:10514368-10514390 TGTTAAATTTTCATTCATCAGGG + Intergenic
1140077332 16:71713392-71713414 TGTCAAATTCTTCTTCATAGAGG - Intronic
1141205148 16:81927758-81927780 GGTCAAATACTCCTTCCTCCAGG - Intronic
1144172870 17:12676651-12676673 TCTCAAATTCTCATTAATCCTGG + Intronic
1157457780 18:47851953-47851975 GGTAAAATTATCATTCATCAAGG + Intronic
1158828238 18:61248572-61248594 GGACAAATTCTCATCAATAGAGG - Intergenic
1159880492 18:73854317-73854339 GGTCACATTCTGATGTATCGAGG - Intergenic
1162875798 19:13620053-13620075 GATCCAATTATCATTCATCTTGG + Intronic
1166602805 19:44113067-44113089 GCTCAAAATCTCATTCTTCAGGG - Intronic
1166786139 19:45368471-45368493 GGTCAAATTCTCATTCATCGTGG - Intronic
927406553 2:22776811-22776833 GTTCAATTTCTCATTCATGTAGG - Intergenic
932533577 2:72565872-72565894 TGTCAAATTCTCCTCCATAGGGG - Intronic
933071273 2:77860911-77860933 GGGCAAATTTTCATTCCTCTAGG - Intergenic
936918036 2:117660042-117660064 GGTAAATTCCTCATTCATCCTGG - Intergenic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
937918400 2:127112407-127112429 TGTCAAATTCTCTTTCAAAGTGG + Intergenic
938446068 2:131379957-131379979 AGTCAAATCCTCATTCGTAGGGG + Intergenic
939008611 2:136819179-136819201 GGTCAAATGGTCATTTATCAGGG + Intronic
942701485 2:178716112-178716134 AATCAAATTCTCATTCCCCGTGG - Intronic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
945589476 2:211712073-211712095 GATCAAATTCCCATTGATCTTGG + Exonic
947068786 2:226262412-226262434 GGTCAGATTATCAATCATCCTGG + Intergenic
948376447 2:237524106-237524128 GGTCAAATCCTCATTGACAGGGG + Intronic
1173820650 20:46018119-46018141 GGTCAAATTCATATTCAGCTTGG - Intergenic
1180475556 22:15702470-15702492 GGTGAAATACTCATAAATCGAGG - Intronic
951461515 3:22956434-22956456 GGTCAAATTCTCATTCAAAAAGG + Intergenic
953031310 3:39181606-39181628 GGTCACTGTCTCATTCATCTTGG - Intergenic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
964002081 3:151787057-151787079 GGTAAAATTCTCAAGCATTGTGG - Intergenic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
966111727 3:176410520-176410542 TGTCAAATTGTCATTCAACGTGG + Intergenic
966162322 3:176981574-176981596 CATCAAATTATCATTCATCTAGG + Intergenic
967765883 3:193278882-193278904 GGTTAAAATCTAATTCATCAAGG - Intronic
969387728 4:6866801-6866823 GGACAAAGTCTTATTCATCCAGG - Intronic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
978989643 4:115064479-115064501 GTTGAAATTCTTATTCATCAAGG + Intronic
983819305 4:172172966-172172988 GGTCAAGTTCTCATCCAGCTGGG + Intronic
986320709 5:6630694-6630716 GGTCAGATTTTCATTAATCATGG - Intronic
987027692 5:13944087-13944109 GGTCAAAAACACATTCATAGTGG - Intronic
990219943 5:53576975-53576997 GGCCAAATACTCATTTCTCGGGG + Intronic
990238624 5:53794608-53794630 TATGAAATTCTCATTCATCTTGG - Intergenic
991255040 5:64604232-64604254 GTCCAAGTTCTCATTCCTCGTGG + Intronic
994377226 5:99028564-99028586 AGTGATATTCTCATTCATCAAGG + Intergenic
999034853 5:148336168-148336190 GACAAAATTCTCATTCATCGTGG + Intronic
1000148780 5:158479731-158479753 GGTAAAATTCTCATGTATTGAGG - Intergenic
1000443268 5:161287670-161287692 TGTCCAATTCTCATTCATTTAGG - Intergenic
1002039334 5:176500738-176500760 GATCAAATTTTCATTCTTCCAGG + Intronic
1004377921 6:15106744-15106766 GGTCAAATTCCCATTCCCAGAGG - Intergenic
1016403226 6:143702839-143702861 GGTGAAATTCTAATTTATCATGG + Intronic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1026831764 7:73614671-73614693 GGTCACATTCTCATTCATTTGGG - Intronic
1027736702 7:81941585-81941607 AGTAAAATTCTCATTGATTGTGG - Intergenic
1037022906 8:13995834-13995856 GATCAAAATATCCTTCATCGGGG + Intergenic
1040099612 8:43486684-43486706 GGTGAAATACTCATAAATCGAGG - Intergenic
1048337763 8:133515505-133515527 GGTCAAAACCTCATTCGTAGGGG - Intronic
1048379237 8:133849785-133849807 TGTCAATTTCTCATTCAACAGGG + Intergenic
1051722566 9:20053620-20053642 GGTCATAATCTCATTCATCAGGG - Intergenic
1054931095 9:70636009-70636031 GGACAATTTCTCATTCATGATGG - Intronic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1059063579 9:111059111-111059133 TGGCAAGTTCTCATTCATGGCGG - Intergenic
1060385303 9:123221141-123221163 GGTCATAATCTCCTTCATCTTGG + Intronic
1061116841 9:128618936-128618958 GGTCATTTTCTCATTGATCCAGG - Exonic
1186186657 X:7026941-7026963 TGTCAAAATCTCAGTCATTGTGG - Intergenic
1188416494 X:29941499-29941521 GGTCAAATTCTCATGCAAAAAGG + Intronic
1190219567 X:48502712-48502734 TGTCAAATTCCCCTTCATCGGGG + Intergenic
1192457034 X:71284499-71284521 GGTGAAATTCTAATTCAACTGGG - Intronic
1194010503 X:88554690-88554712 GGTCACATTGGCATTCATCAAGG - Intergenic
1197057487 X:122138244-122138266 TTTCAAATTCTCATTAATCATGG - Intergenic
1202255579 Y:22916925-22916947 GGTCAAAATTTCATTTATTGTGG - Intergenic
1202408570 Y:24550674-24550696 GGTCAAAATTTCATTTATTGTGG - Intergenic
1202462212 Y:25119406-25119428 GGTCAAAATTTCATTTATTGTGG + Intergenic