ID: 1166786922

View in Genome Browser
Species Human (GRCh38)
Location 19:45373155-45373177
Sequence CTGTCTCCAAAAATACAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166786922_1166786925 7 Left 1166786922 19:45373155-45373177 CCCGGCTGTATTTTTGGAGACAG No data
Right 1166786925 19:45373185-45373207 CTCTGTCCCAGCCTGGAGTATGG No data
1166786922_1166786924 0 Left 1166786922 19:45373155-45373177 CCCGGCTGTATTTTTGGAGACAG No data
Right 1166786924 19:45373178-45373200 AGTCTTGCTCTGTCCCAGCCTGG No data
1166786922_1166786926 10 Left 1166786922 19:45373155-45373177 CCCGGCTGTATTTTTGGAGACAG No data
Right 1166786926 19:45373188-45373210 TGTCCCAGCCTGGAGTATGGTGG No data
1166786922_1166786930 21 Left 1166786922 19:45373155-45373177 CCCGGCTGTATTTTTGGAGACAG No data
Right 1166786930 19:45373199-45373221 GGAGTATGGTGGTGTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166786922 Original CRISPR CTGTCTCCAAAAATACAGCC GGG (reversed) Intergenic
No off target data available for this crispr