ID: 1166788942

View in Genome Browser
Species Human (GRCh38)
Location 19:45386096-45386118
Sequence CGTCCAGGAGGAGCACCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166788927_1166788942 25 Left 1166788927 19:45386048-45386070 CCTCCTTCACCGCCTGCTGCACC 0: 1
1: 0
2: 4
3: 75
4: 521
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1166788933_1166788942 1 Left 1166788933 19:45386072-45386094 CCTCCAGCTCCCCGGTCAGCGCC 0: 1
1: 0
2: 2
3: 33
4: 342
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1166788934_1166788942 -2 Left 1166788934 19:45386075-45386097 CCAGCTCCCCGGTCAGCGCCGCG 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1166788938_1166788942 -10 Left 1166788938 19:45386083-45386105 CCGGTCAGCGCCGCGTCCAGGAG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1166788937_1166788942 -9 Left 1166788937 19:45386082-45386104 CCCGGTCAGCGCCGCGTCCAGGA 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1166788932_1166788942 4 Left 1166788932 19:45386069-45386091 CCACCTCCAGCTCCCCGGTCAGC 0: 1
1: 0
2: 3
3: 58
4: 516
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1166788935_1166788942 -8 Left 1166788935 19:45386081-45386103 CCCCGGTCAGCGCCGCGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 80
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1166788930_1166788942 13 Left 1166788930 19:45386060-45386082 CCTGCTGCACCACCTCCAGCTCC 0: 1
1: 0
2: 13
3: 167
4: 1310
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1166788929_1166788942 16 Left 1166788929 19:45386057-45386079 CCGCCTGCTGCACCACCTCCAGC 0: 1
1: 0
2: 6
3: 135
4: 1138
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148
1166788928_1166788942 22 Left 1166788928 19:45386051-45386073 CCTTCACCGCCTGCTGCACCACC 0: 1
1: 0
2: 3
3: 55
4: 604
Right 1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166788942 Original CRISPR CGTCCAGGAGGAGCACCAGA GGG Exonic
900437667 1:2639295-2639317 GGTCCAGGAGGAGCCTCAGCGGG + Intronic
900527790 1:3137563-3137585 CGTCCAGGAGGACCGCCTGGAGG + Intronic
901823232 1:11843760-11843782 CGTCCTGGAGGAGCAGCGGATGG + Intergenic
903044259 1:20553759-20553781 CATCCAGGAGGAGGACGAGGAGG + Exonic
913259802 1:116987846-116987868 ACTCCAGGAGGAGCAGAAGAGGG + Exonic
916536723 1:165710340-165710362 GGTCCAGGAGGAGAACAAGCAGG + Intergenic
920492158 1:206424843-206424865 AGTCCAGTAGGAGCACAAAATGG - Intronic
920697124 1:208189435-208189457 GGTCCAGCAGGCCCACCAGAAGG + Intronic
922709381 1:227815767-227815789 CCACCAGGAGCAGCAGCAGAAGG - Exonic
922750012 1:228065878-228065900 AGTCCACGGGGAGAACCAGAGGG + Intergenic
922793336 1:228322994-228323016 AGTCCAGGAGGAGCAGGTGAGGG - Intronic
1069446522 10:68477724-68477746 CGTGAAGGAGTAGCAACAGATGG - Intergenic
1069557570 10:69407929-69407951 GCTCCATGAGGGGCACCAGATGG + Intronic
1070328389 10:75402128-75402150 TGTCCAGAAGGAGCACCGGTGGG + Intergenic
1070599085 10:77853386-77853408 GCTCCACGAGGAGGACCAGAAGG - Exonic
1071589988 10:86863617-86863639 GGCCCAGAAGGAGAACCAGAAGG - Intronic
1074386259 10:113018980-113019002 CGTCCAGAGGGAGCACAAGAGGG + Intronic
1077035968 11:494661-494683 CGTCCAGGGAGAGCAGCAGCAGG + Exonic
1078146599 11:8725940-8725962 ATTCCAGGAGGAGTTCCAGAAGG + Intronic
1078979070 11:16511329-16511351 TATGCAGAAGGAGCACCAGATGG - Intronic
1079097907 11:17522791-17522813 CCTCCAGGAGCAGCAGGAGATGG - Exonic
1080012570 11:27472920-27472942 TGGCCAAGAGGAGGACCAGAGGG + Intergenic
1083995021 11:66267515-66267537 AGGCCAGGAGGAGCGCGAGAAGG - Exonic
1084652405 11:70496841-70496863 CGTCCAGGAGAACCACGAGGCGG + Intronic
1086799358 11:91152509-91152531 CCTCCAGTAGGCGCCCCAGAGGG + Intergenic
1089695797 11:120215711-120215733 CTTCCAGGAGGTAGACCAGAAGG - Intronic
1090801350 11:130174475-130174497 CCCCCAGGAGAAGCAGCAGAGGG - Intronic
1090882901 11:130849778-130849800 CGTTAAGGAGGAGCAACAAATGG - Intergenic
1101605845 12:106247443-106247465 CGTCCTGGAGGAGGTCCAGCAGG - Exonic
1105403489 13:20115362-20115384 AGGCCAGGAGTAGCCCCAGAGGG - Intergenic
1109676345 13:65679361-65679383 TGACCAGGAGGATCACCATATGG - Intergenic
1112388907 13:98964857-98964879 CGTGCTTGAGGAGCACCGGATGG + Intronic
1114043839 14:18704198-18704220 AGGCCAGGAGGAGCTCCAGTAGG + Intergenic
1114048125 14:18894640-18894662 AGGCCAGGAGGAGCTCCAGTAGG + Intergenic
1114114393 14:19507004-19507026 AGGCCAGGAGGAGCTCCAGTAGG - Intergenic
1114116088 14:19624757-19624779 AGGCCAGGAGGAGCTCCAGTAGG - Intergenic
1114502671 14:23182706-23182728 CTCACAGGAGGACCACCAGAGGG + Intronic
1119433428 14:74583127-74583149 TGTCCTGGAGGAAGACCAGAGGG - Intronic
1121705419 14:95989669-95989691 CATCTAGGAGGAACAACAGAGGG - Intergenic
1121901531 14:97697552-97697574 CGCCCAGGAGTAGGTCCAGATGG + Intergenic
1122072532 14:99213915-99213937 CCTCTCGGAGGAGCACCGGAGGG - Intronic
1122313993 14:100815058-100815080 GGCCCAGGAGGTGCCCCAGAAGG + Intergenic
1122608523 14:102964530-102964552 TGTCCAGGAGGAGCTCAGGAAGG - Exonic
1127464168 15:59227544-59227566 AGTCCAGGTGGGGAACCAGATGG - Exonic
1129033168 15:72632768-72632790 GGTCCAAAAGGAGCACCTGAAGG - Intergenic
1129407958 15:75331623-75331645 GGTCCAAAAGGAGCACCTGAAGG - Intergenic
1129733882 15:77948775-77948797 GGTCCAAAAGGAGCACCTGAAGG + Intergenic
1129841702 15:78747228-78747250 GGTCCAAAAGGAGCACCTGAAGG - Intergenic
1130251126 15:82300939-82300961 CGTGCAGGAAGAGCAGCTGAGGG + Intergenic
1130692608 15:86096985-86097007 CTTCCAGGAAGATCACAAGAAGG - Intergenic
1132157350 15:99504922-99504944 CCTCCAGGAGGAGCTCCAGGAGG - Intergenic
1132541200 16:510666-510688 CGCCCTGGAGGAGCAGCTGAAGG + Exonic
1133178919 16:4037812-4037834 GGTTAAGGAGGAGCATCAGAAGG + Intronic
1133924349 16:10181731-10181753 AGTGCAGGAGGGGCACCAGGGGG - Intronic
1136277046 16:29185021-29185043 CGTCCAGGTGAAGCCCCACAGGG + Intergenic
1137679151 16:50324060-50324082 CTTCCATGTGGAGCACCAAAGGG - Intronic
1138339141 16:56277236-56277258 CCTCCAGGAGGAGCGGCAGATGG - Intronic
1138662891 16:58535389-58535411 GGTCAAGGAGGAGCGCAAGAAGG + Intronic
1140132548 16:72176244-72176266 GGGCCAGGAGGAGCAGGAGAAGG + Intronic
1141887432 16:86902100-86902122 CGTCCAGGAGAGGCACCTGAGGG + Intergenic
1141950033 16:87334154-87334176 CGTCCTGGAGGTGCGCGAGAGGG - Exonic
1142081420 16:88151070-88151092 CGTCCAGGTGAAGCCCCACAGGG + Intergenic
1143951913 17:10639381-10639403 CCTCCAAGAGGCGCACCAGCAGG - Exonic
1146478160 17:33179873-33179895 CATCAAGGAGGACCACCAAATGG - Intronic
1147267591 17:39244275-39244297 TGGCCAGGAGGAGCAGCAGGAGG - Intergenic
1152071946 17:78138417-78138439 GGCCCAGGAGGAGCACTAGCTGG - Exonic
1153560128 18:6363279-6363301 CGTCCAGGGGCAGCCCCTGATGG + Intronic
1156468093 18:37360754-37360776 AGTTCAGGAGGACCACCAGTGGG + Intronic
1163584511 19:18156532-18156554 CGGCCAGCAGGAGGACCAGAGGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166788942 19:45386096-45386118 CGTCCAGGAGGAGCACCAGAGGG + Exonic
1167353011 19:48987331-48987353 CGTCCAGGAGCACCACCAGAGGG + Exonic
925059957 2:883448-883470 GGCCCAGGGGGAGCAGCAGAGGG + Intergenic
925999956 2:9322754-9322776 AGTCCAGGAGGAGAAACAGTGGG + Intronic
927177698 2:20422051-20422073 CATCCGGGAGCAGCACTAGAAGG + Intergenic
927190820 2:20515777-20515799 CTTCCAAGAGTGGCACCAGATGG + Intergenic
930745628 2:54880524-54880546 AGACCTGGAGGAGCAGCAGATGG + Intronic
932091107 2:68807328-68807350 CCACCAGGATGGGCACCAGATGG - Exonic
932265871 2:70366416-70366438 CCTCCTGGAGGAGCACCACCTGG - Intergenic
937214642 2:120303865-120303887 CGACCAGGAGGAGCCAAAGAAGG - Intergenic
937390653 2:121483028-121483050 CATCCAGCAGGAGCAAGAGAGGG + Intronic
938770476 2:134496928-134496950 CTTCCAGGCGGAGCTGCAGAGGG - Intronic
946386140 2:219385663-219385685 CATCCAGGAGGAGCTGGAGAAGG - Exonic
947544893 2:231003581-231003603 TGACAAGGAGGAGCACCAGAGGG - Intronic
948605062 2:239129664-239129686 CCTCCAGGAGGAGCAGGAGCCGG - Intronic
949052563 2:241904968-241904990 CTTCCAGGAGGAGGCCCCGAGGG - Intergenic
1170568626 20:17620714-17620736 CGCAGAGGAGGAGCTCCAGAAGG - Exonic
1171813565 20:29763874-29763896 CGGCAAGGTGGAGGACCAGAGGG - Intergenic
1171896509 20:30814258-30814280 CGGCAAGGCGGAGGACCAGAGGG - Intergenic
1172044961 20:32073783-32073805 CTTCCAGAAGGGGGACCAGATGG + Exonic
1173166048 20:40688052-40688074 CGTCCAGCAGAAGCACCACCTGG - Exonic
1174475821 20:50795077-50795099 CGTCCACGAGCAGCATCAGGAGG - Exonic
1174761745 20:53213371-53213393 CATCCAGGTGCAGCAGCAGAAGG - Intronic
1175191765 20:57216447-57216469 CCTCCTGGAGCAGCTCCAGAGGG + Intronic
1176025038 20:62981511-62981533 AGTCCAGCAGGAACCCCAGAAGG - Intergenic
1180466660 22:15617314-15617336 AGGCCAGGAGGAGCTCCAGTAGG + Intergenic
1180905568 22:19408528-19408550 CCTCCAGGAGGATGACGAGAAGG - Exonic
1180910971 22:19449594-19449616 TCTCCAGGAGAAGCCCCAGAGGG + Intergenic
1183628929 22:39021579-39021601 GGCCCAGCAGGACCACCAGAAGG - Intronic
1185049327 22:48545652-48545674 CATCCAGGAGCAGTACCAGGTGG + Intronic
950265006 3:11567058-11567080 TGAGCAGGAGAAGCACCAGAGGG + Intronic
952713193 3:36452927-36452949 AGGCCAGGGAGAGCACCAGAAGG - Intronic
953520144 3:43634676-43634698 CTTCCAGGATGGTCACCAGATGG - Intronic
955161435 3:56468316-56468338 CGGCCAGGAGGAGCAGGAGCCGG + Exonic
956507742 3:69960758-69960780 CGTCCGGGAGGAGCACCACTAGG - Intronic
961319673 3:126063994-126064016 TGTCCAGGAAGGGCAACAGAGGG - Intronic
962432873 3:135336265-135336287 CCTCCCAGGGGAGCACCAGAGGG + Intergenic
963886527 3:150588912-150588934 CCTTCAGGAGGAGTTCCAGAAGG + Intronic
964684013 3:159375271-159375293 AGCCCAGGAGGGGCTCCAGAGGG + Intronic
968138592 3:196237480-196237502 CTTGCTGGAGGAGCAGCAGAGGG + Exonic
968543269 4:1179053-1179075 AGTCCAGGAGGACACCCAGAAGG + Intronic
968653940 4:1770679-1770701 CCCCCAGGAGAAGCACCTGATGG + Intergenic
968879247 4:3290764-3290786 CCTACAGGAGGAGAACCACAGGG + Intergenic
972333225 4:38082299-38082321 CCACCAGGATGAGCACCTGAGGG - Intronic
978768693 4:112431615-112431637 CTTCTAGAAGGAGCTCCAGAAGG + Exonic
982576308 4:157114627-157114649 CGGCCAAGAGAAGCACAAGAAGG - Intronic
985445424 4:190018901-190018923 CGGCAAGGCGGAGGACCAGAGGG + Intergenic
985535505 5:463140-463162 TTTCCAGCAGGACCACCAGATGG - Intronic
986162469 5:5242199-5242221 CCTCCAGGAGCAGCACTGGAAGG - Intronic
986195533 5:5533963-5533985 CAGCCAGGAGCAGCACCCGAAGG - Intergenic
990476415 5:56165374-56165396 AGGCCAGGATGAGCACCAGTGGG + Intronic
994028100 5:95108290-95108312 AGCCCATGAGGAGGACCAGATGG + Intronic
996083731 5:119282995-119283017 CGACCAGGAGGAACACAATAGGG - Intronic
996639706 5:125737473-125737495 AGTCCAGGACCAGGACCAGACGG - Intergenic
997032059 5:130141850-130141872 AGTACAGGAGGCACACCAGAAGG + Intronic
997232078 5:132252796-132252818 CCTCCAGGCAGAGCAGCAGAGGG - Intronic
998173337 5:139885305-139885327 AGACTAGGAGGAGCACCACAGGG + Intronic
998451136 5:142235556-142235578 CGACCAGCTGGAGCAGCAGAAGG - Intergenic
998502057 5:142642117-142642139 CTTCTAGGAGGAGCACAATAGGG + Intronic
1000410749 5:160933526-160933548 CTTCCAGGAGCAGCTGCAGATGG - Intergenic
1000962031 5:167611421-167611443 CATCCAGGAGGTGCCACAGAAGG + Intronic
1002083101 5:176749032-176749054 CTTCCAGGAGCACCACCAGGTGG + Intergenic
1002108700 5:176893525-176893547 GGGCCACGAGGAGCACCAGCTGG + Intronic
1006900027 6:37493983-37494005 AGGCCAGGAAGAGCACCGGAAGG - Intronic
1006990801 6:38213131-38213153 CTTCCAGAAGGATCACCAGACGG + Intronic
1017246591 6:152233780-152233802 CGTCCAGGAGAAGCTCCACCAGG - Exonic
1018559683 6:165088890-165088912 CATCCTGGAGGAGCAACAAAAGG - Intergenic
1018629279 6:165808292-165808314 CTTCTGGGAGGAGGACCAGAGGG - Intronic
1018885085 6:167928501-167928523 CTTCAAGGAGGAGCTCCAGAAGG + Intronic
1019721382 7:2574254-2574276 CGTTCAGTTGGGGCACCAGAGGG + Intronic
1026778011 7:73243516-73243538 TGTGCACGAGGAGCTCCAGATGG - Intergenic
1027018863 7:74796910-74796932 TGTGCACGAGGAGCTCCAGATGG - Exonic
1027069166 7:75149027-75149049 TGTGCACGAGGAGCTCCAGATGG + Exonic
1029109418 7:98204913-98204935 ATTCCAGGGGCAGCACCAGAGGG - Intronic
1035435519 7:158856596-158856618 CGACAAGCAGGAGCAGCAGAGGG - Exonic
1035495614 7:159323041-159323063 GGTCCAGGAATAGCACCAGATGG + Intergenic
1037529788 8:19761735-19761757 AGTCCAGGAGGAGGACTAAAGGG + Intergenic
1039888393 8:41668569-41668591 GGTCCAGAAGAAGCAGCAGATGG + Intronic
1041362604 8:57068655-57068677 CACCCAGAAGGGGCACCAGAAGG + Intergenic
1043219570 8:77642689-77642711 CCTCCAGGAGGTGTTCCAGAAGG + Intergenic
1045173647 8:99697250-99697272 CATCCAGCAGGAGCACCACAAGG + Intronic
1047624782 8:126645511-126645533 TGTCCAGGAAGAGCAGGAGAGGG - Intergenic
1048231073 8:132642670-132642692 CGCCCAGAAGCAGCTCCAGATGG + Intronic
1049238145 8:141523028-141523050 GGTGCAGGCGGAGCCCCAGAGGG + Intergenic
1049734900 8:144199669-144199691 CATCCTGGAGGGGCAGCAGATGG + Intronic
1052890411 9:33694299-33694321 CATCCAGGAGGAGCACATAAGGG - Intergenic
1058720326 9:107758480-107758502 CGTCCAGGTGGAGCATGTGATGG + Intergenic
1060932143 9:127495981-127496003 CCTCCAGGAGGGCCACCAGCTGG - Exonic
1185549326 X:970797-970819 AGTGCAGGAGGATCCCCAGATGG - Intergenic
1190528658 X:51353087-51353109 CAAACAGGAGGAGCACCAAAAGG - Intergenic
1200062566 X:153490087-153490109 AGCCCAGGAGCAGCACCAGGAGG - Intronic
1200796553 Y:7346199-7346221 AGAACAGGAGGAGCCCCAGAGGG - Intergenic