ID: 1166794638

View in Genome Browser
Species Human (GRCh38)
Location 19:45419189-45419211
Sequence TAGCGGAGGCTGGTGGGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 522}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166794627_1166794638 8 Left 1166794627 19:45419158-45419180 CCCATGGATGTAGTCTGGGTGCA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG 0: 1
1: 0
2: 5
3: 47
4: 522
1166794621_1166794638 25 Left 1166794621 19:45419141-45419163 CCCAGGCTCTGCAGCCGCCCATG 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG 0: 1
1: 0
2: 5
3: 47
4: 522
1166794620_1166794638 26 Left 1166794620 19:45419140-45419162 CCCCAGGCTCTGCAGCCGCCCAT 0: 1
1: 0
2: 0
3: 33
4: 310
Right 1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG 0: 1
1: 0
2: 5
3: 47
4: 522
1166794622_1166794638 24 Left 1166794622 19:45419142-45419164 CCAGGCTCTGCAGCCGCCCATGG 0: 1
1: 0
2: 1
3: 26
4: 315
Right 1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG 0: 1
1: 0
2: 5
3: 47
4: 522
1166794626_1166794638 11 Left 1166794626 19:45419155-45419177 CCGCCCATGGATGTAGTCTGGGT 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG 0: 1
1: 0
2: 5
3: 47
4: 522
1166794628_1166794638 7 Left 1166794628 19:45419159-45419181 CCATGGATGTAGTCTGGGTGCAG 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG 0: 1
1: 0
2: 5
3: 47
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166794638 Original CRISPR TAGCGGAGGCTGGTGGGGGC AGG Exonic
900018754 1:172213-172235 TAGGTGGTGCTGGTGGGGGCTGG - Intergenic
900049012 1:530808-530830 TAGGTGGTGCTGGTGGGGGCTGG - Intergenic
900071243 1:772632-772654 TAGGTGGTGCTGGTGGGGGCTGG - Intergenic
900105537 1:979365-979387 GATCCGAGGCTGGTGGGGCCGGG + Exonic
900117083 1:1033504-1033526 GAGCGGAGGCGGGTGCGGCCGGG - Intronic
900143161 1:1146928-1146950 TTTGGGAGGCTGGCGGGGGCAGG + Intergenic
900285453 1:1897275-1897297 TTTGGGAGGCTGGTGGCGGCGGG - Intergenic
900540943 1:3202368-3202390 TAGGGGAGGCTGGGGGAGGCTGG + Intronic
900796078 1:4709210-4709232 TGGTGGGGGCTGGTGGGGGCTGG + Intronic
900796082 1:4709220-4709242 TGGTGGGGGCTGGTGGGGCCTGG + Intronic
900796087 1:4709230-4709252 TGGTGGGGCCTGGTGGGGGCCGG + Intronic
901044204 1:6385815-6385837 TGCCGGGGGCTGGTGGGGGAGGG - Intronic
901061681 1:6474649-6474671 GGGCGGGGGCTCGTGGGGGCGGG - Intronic
901251421 1:7783410-7783432 TAGCGGAGGATGGGGGCGGTTGG + Intergenic
901640197 1:10689157-10689179 TAGAGGAGGCTGATGGAGGCTGG + Intronic
901667445 1:10834866-10834888 CAGAGGAGGCTGGTGGCGGATGG + Intergenic
902369586 1:15997447-15997469 TGGAGGCAGCTGGTGGGGGCAGG - Intergenic
902870707 1:19312178-19312200 GCGCGGAGGCAGTTGGGGGCGGG + Intergenic
903017909 1:20373601-20373623 GAGCGGAGGCTCCTGGTGGCTGG - Intergenic
903291406 1:22316488-22316510 TACAGAAGGCTGGTGGTGGCGGG - Intergenic
903302740 1:22390773-22390795 TAGGGGAGGGAGGTGGAGGCTGG - Intergenic
903384644 1:22918391-22918413 GAGCTGAGCCTGGCGGGGGCGGG + Intergenic
903482234 1:23662158-23662180 CTGTGGAGGATGGTGGGGGCAGG - Intergenic
903666093 1:25008648-25008670 TGGTGGTGGCTGGAGGGGGCAGG - Intergenic
903850220 1:26301344-26301366 TGGAGGAGGCTGGAGGGGGAAGG + Intronic
904454869 1:30641508-30641530 AAGGAGAGGCTGGCGGGGGCGGG - Intergenic
904473706 1:30751258-30751280 GTGAGGAGGCCGGTGGGGGCAGG - Intronic
904486277 1:30826313-30826335 TAGAGGAGGATGGAGAGGGCTGG + Intergenic
905282202 1:36856387-36856409 GAGCGGTGGCTAGAGGGGGCGGG - Intronic
905603363 1:39273283-39273305 TAGCTGGGCGTGGTGGGGGCGGG - Intronic
905900877 1:41581362-41581384 AAAGGGAGACTGGTGGGGGCAGG + Exonic
906058681 1:42934683-42934705 TTGCGGAGGCTGCTGGGAGCCGG - Intronic
906286677 1:44592291-44592313 TAGGGGGAGCTGGTGGTGGCAGG + Intronic
908772293 1:67608079-67608101 TAGCTGAGACTGGAGGTGGCAGG + Intergenic
910176726 1:84438679-84438701 TGGCGGTGGGTGGTGGGGGAAGG + Intergenic
911428755 1:97756336-97756358 TAGCGCAGGGTGGTGGGAGCAGG + Intronic
912746964 1:112253023-112253045 TACTGGAAGGTGGTGGGGGCTGG + Intergenic
915335122 1:155136411-155136433 TACCAGAGGGAGGTGGGGGCGGG + Intronic
916382796 1:164231626-164231648 AAGGGGAGGGTGGTGGGGGTTGG + Intergenic
916466141 1:165076344-165076366 TAGAGGAGGATAGTGGAGGCAGG + Intergenic
916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG + Intergenic
917326363 1:173836392-173836414 TAGCGGGGCATGGTGGTGGCAGG + Intronic
917806450 1:178618152-178618174 GAGCAGAGGTGGGTGGGGGCTGG + Intergenic
918825385 1:189316939-189316961 AAGCTGTGGCTGGTAGGGGCTGG - Intergenic
919224343 1:194675667-194675689 TACCAGAGGCTGTTTGGGGCGGG - Intergenic
919856744 1:201711377-201711399 GAGGGGAGGCTGGGTGGGGCGGG - Intronic
920122875 1:203672002-203672024 TAGTGGCAGCTGGTGGGGGCTGG + Intronic
920285356 1:204874861-204874883 GAGGGGTGGGTGGTGGGGGCAGG + Intronic
920298179 1:204972515-204972537 GAGCAGAGGCTGGAGAGGGCTGG - Intronic
921167667 1:212518571-212518593 TAGCTGAGGGAGGAGGGGGCAGG + Intergenic
921866640 1:220094068-220094090 GAGCGGCGGGTAGTGGGGGCGGG - Intergenic
922173549 1:223177532-223177554 CAGTGGAGGCAGGTGTGGGCAGG - Intergenic
922634354 1:227151083-227151105 TAGAGAAGGATGGTGGGGACTGG - Intronic
923354984 1:233145646-233145668 TACCGGAGGCTGCCAGGGGCAGG + Intronic
1063032119 10:2246089-2246111 TTTGGGAGGCTGGTGGGGGTGGG + Intergenic
1063301107 10:4849595-4849617 TACCAGAGGCTGGGGAGGGCAGG + Intergenic
1063558981 10:7108861-7108883 CAGCTGAGGCAGGTTGGGGCAGG + Intergenic
1064211489 10:13363889-13363911 TAGTGGAGGCAGGACGGGGCGGG - Intergenic
1065111602 10:22445327-22445349 AAACGCAGGGTGGTGGGGGCGGG - Intronic
1065372571 10:25003822-25003844 TATCGGAGGCTGGGGGTGGAAGG - Intronic
1066278178 10:33889051-33889073 TAGCGGGGGGCGGTGGGGTCGGG - Intergenic
1066296358 10:34057216-34057238 TAGCACAGGCGGGTGGGGACAGG - Intergenic
1067028859 10:42866884-42866906 TAGGCGAGGCTGCTGGGAGCCGG - Intergenic
1067044205 10:42975281-42975303 CAGGGGAGGCTGGAGGGGGTGGG - Intergenic
1067090131 10:43262226-43262248 TGGAGGAGGCTGGCGGGAGCTGG - Intronic
1067513910 10:46920536-46920558 GAGCAGAGGGTGCTGGGGGCAGG + Intronic
1067648344 10:48131296-48131318 GAGCAGAGGGTGCTGGGGGCAGG - Intergenic
1068334301 10:55612004-55612026 TACCAGAGGCTGGAGGAGGCGGG + Intronic
1070175785 10:73968132-73968154 AAGTGGAAGGTGGTGGGGGCAGG - Intergenic
1070429115 10:76318457-76318479 CAGCAGAGGCTGGTGGGGAGGGG - Intronic
1070948804 10:80414306-80414328 TAGCTGTGTCAGGTGGGGGCTGG + Intronic
1071060411 10:81564125-81564147 GAGAGGAGGCAGTTGGGGGCTGG + Intergenic
1071426251 10:85556782-85556804 TAGAGGATGCTGATGGGGGTTGG - Intergenic
1072923794 10:99598603-99598625 CAGAGGAGGCTAGTGGGAGCAGG - Intergenic
1073144697 10:101272792-101272814 TAGTAGAGGTTGGTGGAGGCCGG + Intergenic
1073285109 10:102382785-102382807 GAGGGTAGGCAGGTGGGGGCTGG + Exonic
1073466583 10:103697805-103697827 AGGGAGAGGCTGGTGGGGGCAGG + Intronic
1073991578 10:109267742-109267764 AAGAAGAGGCTGGTGTGGGCTGG - Intergenic
1075621913 10:123934346-123934368 CAGCGGAGCCTGGGAGGGGCAGG - Intronic
1076180823 10:128405775-128405797 TGGGTGAGGCTGGTGGAGGCCGG - Intergenic
1076314620 10:129531766-129531788 TAGCGGGGGCTGGTGGGGGTGGG + Intronic
1076917864 10:133433361-133433383 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1076937862 10:133577438-133577460 CAGCGGAGGCAGGTAGAGGCGGG - Intergenic
1076975356 11:167409-167431 TAGGTGGTGCTGGTGGGGGCTGG - Intergenic
1077192099 11:1259847-1259869 CAGCAGAGGCATGTGGGGGCAGG + Intronic
1077321899 11:1946536-1946558 TGCCAGAGGCTGGAGGGGGCTGG + Intergenic
1077355340 11:2114265-2114287 TGGTGGAGGGTGGAGGGGGCAGG - Intergenic
1077382271 11:2249716-2249738 TAGGTGGGGCTGGTGAGGGCGGG + Intergenic
1077383948 11:2260294-2260316 TAGCGGCTCCAGGTGGGGGCAGG - Intergenic
1077635950 11:3841247-3841269 CCGCGGAGGCTGGTGGGGGCGGG - Intergenic
1077920691 11:6639930-6639952 CAGAGGAGGCTAGAGGGGGCAGG + Exonic
1078191291 11:9094063-9094085 TGTCAGAGGCTGCTGGGGGCGGG - Intronic
1078531614 11:12140870-12140892 TAGAGAAGGTTGGTGGGGGAAGG - Intronic
1078771794 11:14358710-14358732 GAGCGGCGGCGGGCGGGGGCTGG - Intronic
1079127871 11:17731701-17731723 TAGCTGGGGCTGGTGGGGGTGGG - Intergenic
1079642977 11:22829844-22829866 CAGTGGAGGGCGGTGGGGGCGGG - Exonic
1079645913 11:22863647-22863669 TGGCGGAGGGAGGTGGGGGGTGG + Intergenic
1080742800 11:35081804-35081826 TAGGAGGGGCTGGTGGGAGCTGG - Intergenic
1080836258 11:35943951-35943973 TAGCGGAGCCGGGCCGGGGCCGG + Intergenic
1081085102 11:38789663-38789685 TAGCCCAGGCTGGTGGGTGGTGG - Intergenic
1081743521 11:45457326-45457348 GTGCTGAGGCTGGTGTGGGCTGG + Intergenic
1083229881 11:61310097-61310119 TAGCTTAGGCTGGTGGGGGATGG - Intronic
1083259060 11:61513461-61513483 GCCTGGAGGCTGGTGGGGGCGGG - Intergenic
1083388985 11:62334253-62334275 TAGCTGAGACTGGTGGGGATGGG + Intergenic
1083446887 11:62714138-62714160 GAGGGGAGGGTGGTGGGGGGGGG - Exonic
1083674681 11:64318843-64318865 AAGCCGAGGCGGGGGGGGGCGGG - Intronic
1083729438 11:64644809-64644831 GAGAGGAGGCTGGGAGGGGCTGG + Intronic
1084271170 11:68029963-68029985 TAGCCGAGCCTGGTGGTGGCAGG + Intergenic
1084275518 11:68049297-68049319 GGGCTGCGGCTGGTGGGGGCCGG + Intronic
1085283439 11:75345309-75345331 TAGGGAAGGCGGGAGGGGGCTGG + Intronic
1087814276 11:102641263-102641285 CAGAGGAGGCTGGCGGGGCCAGG + Intergenic
1088606758 11:111540610-111540632 TGGAGGAGGCTGTCGGGGGCGGG + Intronic
1089665170 11:120013663-120013685 TGCCGGAGGCTGGGGGGTGCAGG + Intergenic
1090259793 11:125311024-125311046 TGGGGGAGTCTGGTGGGGGAAGG + Intronic
1090263914 11:125342356-125342378 GAGCAGGGGCTGGTGGGGGAAGG - Intronic
1090405337 11:126473059-126473081 GAGAAGAGGATGGTGGGGGCTGG - Intronic
1090954732 11:131504092-131504114 TGGAGGAAGCTGGTGGGGCCAGG - Intronic
1091048477 11:132347213-132347235 TAGCGGGGGGGGGGGGGGGCGGG - Intergenic
1091265113 11:134264360-134264382 TAGCCGGGCCTGGTGGGGCCTGG + Intronic
1091273066 11:134331776-134331798 GAGAGGGGGCTGGCGGGGGCGGG - Intergenic
1202804915 11_KI270721v1_random:1849-1871 TGCCAGAGGCTGGAGGGGGCTGG + Intergenic
1091973929 12:4810124-4810146 TCCCGGAGGCCGGCGGGGGCGGG + Exonic
1092878842 12:12872137-12872159 CAGGAGAGGCTTGTGGGGGCTGG + Intergenic
1093858859 12:24138583-24138605 TAGAGGAGGTTGGTGGGGGATGG + Intergenic
1096677596 12:53233902-53233924 TAGTGGTGGCTGGTGGGAGGAGG + Intergenic
1096707476 12:53431360-53431382 CAGGGGAGGATGGTAGGGGCAGG - Exonic
1096817136 12:54208768-54208790 TGGGGGAGGCTTGTGGAGGCAGG + Intergenic
1096989051 12:55783572-55783594 TAGGGGAGGCTGGGGGGAGGTGG + Intronic
1097250343 12:57629028-57629050 GAGGTGAGGCTGGTAGGGGCAGG - Exonic
1097401968 12:59139020-59139042 TGTCGGGGGCTGGAGGGGGCTGG - Intergenic
1098514560 12:71358819-71358841 TAGCTTGGGCTTGTGGGGGCTGG - Intronic
1100406890 12:94279730-94279752 GAATGGAAGCTGGTGGGGGCAGG - Intronic
1101269936 12:103132778-103132800 TAGCGGTGGCTGCTGTGGGTGGG - Intergenic
1102016893 12:109654154-109654176 TAGCTGAGGCTGGGGGAGGTGGG + Intergenic
1102212749 12:111138931-111138953 TAAGGGAAGCAGGTGGGGGCAGG - Intronic
1103462619 12:121117194-121117216 TGACAGAGGCTGGTGGGGCCTGG - Intergenic
1103540376 12:121662092-121662114 TAGCAGGGGCTGGTGGGGTGGGG + Intronic
1103598376 12:122038187-122038209 TTTGGGAGGCTGGTGTGGGCGGG + Intronic
1103884922 12:124193200-124193222 TAGCGCAGGCTGGATGTGGCTGG + Intronic
1104857762 12:131909889-131909911 AAGAGGAGGCTGGTGTGAGCAGG - Intronic
1106099351 13:26681195-26681217 TCGCCGAGGCAGATGGGGGCCGG - Exonic
1106357686 13:28999778-28999800 TACCAGAGGCTGGCGGGGGATGG - Intronic
1108066745 13:46585767-46585789 TAGCCGAGGAAGGTGGGGGTGGG - Intronic
1108575050 13:51783259-51783281 CAGGGGAGGCTGGTGGAGTCTGG - Intronic
1108575463 13:51786591-51786613 TTGCGGGGGCGGGTGGGGCCTGG - Intronic
1111117799 13:83803810-83803832 TAGCTGAGTGTGGTGGTGGCTGG + Intergenic
1112360530 13:98713711-98713733 GAGGTGAGGCTGGTGGAGGCTGG + Intronic
1113034803 13:106037283-106037305 TAGCAGAGTCTGGTTGGGGTAGG - Intergenic
1113098385 13:106690554-106690576 TATCAGAGGGTGGTGGGGGGCGG + Intergenic
1113378612 13:109784714-109784736 GAGCCGGGGCTGGTGGCGGCGGG + Exonic
1113706247 13:112434595-112434617 TTCCGGAGGCTGGTGGGTGGGGG - Exonic
1116781283 14:49240603-49240625 CAGGGTAGGTTGGTGGGGGCAGG + Intergenic
1118438239 14:65790460-65790482 TAGCTGGGGCTGGTAGGGCCTGG + Intergenic
1118776985 14:68979331-68979353 GAGCCGAGGCGGGCGGGGGCGGG + Intronic
1119031602 14:71197095-71197117 TGGCGGAGGTGGGTGGGTGCAGG + Intergenic
1119145576 14:72310745-72310767 CAGGGGAGGCTGGTGGTGGAAGG - Intronic
1119685604 14:76628580-76628602 TAGGAGAGGCTGGTGGGGCCTGG - Intergenic
1119739195 14:77003155-77003177 CAGCAGAGGATGGTGGGGGCTGG + Intergenic
1119861258 14:77937805-77937827 TGGCGGGGGGTGGTGGGGGTCGG - Intergenic
1121720933 14:96108263-96108285 CAGTGGAGGCAGGTGGGGACAGG - Intergenic
1122280396 14:100618790-100618812 CAGGGGAGGGTGGTGGGGGTTGG + Intergenic
1122414094 14:101540584-101540606 GAGCAGAGGCTGCCGGGGGCAGG + Intergenic
1122723284 14:103734328-103734350 CAGCGGAGGGTGGTTGGGGTTGG - Exonic
1122768175 14:104085570-104085592 CCGCGGAGGCGGGCGGGGGCAGG - Intergenic
1122881885 14:104693952-104693974 AAGCAGAGGCAGGTGGGGACAGG - Intronic
1122953629 14:105059988-105060010 TGGCGGTGGGTGGTGTGGGCCGG + Intronic
1123030915 14:105450613-105450635 TGGCTGAGGCAGGTGGGGGCAGG + Intronic
1123035872 14:105471722-105471744 TAGAGTTGGCTGGTGGGGGCTGG - Intergenic
1123072041 14:105646728-105646750 GAACAGGGGCTGGTGGGGGCAGG - Intergenic
1124423082 15:29539212-29539234 TGGTGGATGCTGGTGGGGGTGGG - Intronic
1124538763 15:30567351-30567373 TGGTGGAGGCGGGGGGGGGCGGG + Intergenic
1125525126 15:40369727-40369749 AGGCAGGGGCTGGTGGGGGCCGG - Exonic
1125672054 15:41480865-41480887 GAGGGGAGGCTGGTGGGAGATGG - Exonic
1125793353 15:42386472-42386494 TAGTGGAAGGTGGTGGGGGAGGG - Intronic
1128806732 15:70536598-70536620 TGGCGGAGTCTGGTGGGGGAGGG + Intergenic
1128867871 15:71128975-71128997 TGGAGGAGGCTGGTGGAGGATGG + Intronic
1129335894 15:74852045-74852067 TAAGGGAGGCTGCTGGGGCCTGG - Intronic
1129674235 15:77623666-77623688 AAGGGGAGGCAGGTGGGGGCGGG - Intronic
1131214547 15:90526455-90526477 TAGCGGGGCGTGGTGGTGGCGGG - Intergenic
1132423568 15:101694878-101694900 TACCAGAGGCTGGGGGAGGCAGG + Intronic
1132519746 16:381719-381741 CGGCGGAGGCAGGCGGGGGCCGG + Exonic
1132612517 16:824457-824479 TGGGGGCGGCAGGTGGGGGCTGG - Intergenic
1132994866 16:2817598-2817620 TAACGGACGCTGGAGGGGGATGG + Intronic
1133076212 16:3283060-3283082 TAGCCGAAGCGGGTGGGGCCTGG + Exonic
1133269720 16:4604820-4604842 TAGAGCAGGCTGGCAGGGGCAGG + Intergenic
1133525970 16:6605952-6605974 TAGCGGAGCATGGTTGGGGGTGG + Intronic
1133770467 16:8864721-8864743 GAGCCCAGGGTGGTGGGGGCAGG + Intronic
1135034820 16:19068120-19068142 TAGCGGAGGCTGCTGGTCGTCGG - Intronic
1135057324 16:19241668-19241690 TAGTGGAGGTTCCTGGGGGCAGG + Intronic
1136233324 16:28900504-28900526 TGGAGGAAGCTGGTGGGGGGTGG - Intronic
1136486891 16:30578935-30578957 TAGCCGAGCATGGTGGGGGAGGG - Intronic
1138482581 16:57313327-57313349 GAGGGGAGGCTGGTGGGGATGGG + Intergenic
1139851339 16:69952782-69952804 CAGGGCAGGGTGGTGGGGGCGGG + Intronic
1139853365 16:69963429-69963451 TAGCAGAGGCTGCTGGGAGCTGG - Intronic
1139880316 16:70175694-70175716 CAGGGCAGGGTGGTGGGGGCGGG + Intronic
1139882334 16:70186338-70186360 TAGCAGAGGCTGCTGGGAGCTGG - Intronic
1139908801 16:70383891-70383913 TAGGGGAGGAAGGTTGGGGCTGG - Intronic
1140068313 16:71627766-71627788 TAGGGGAGGGTGGGGGGGGAAGG + Intronic
1140223239 16:73058652-73058674 CAGCGGCGGCTGGCGGGGGTCGG + Intronic
1140370175 16:74409166-74409188 TAGCAGAGGCTGCTGGGAGCTGG + Intronic
1140372194 16:74419823-74419845 CAGGGCAGGGTGGTGGGGGCGGG - Intronic
1140393277 16:74606765-74606787 GAGCGGGGGCTGGTGGGGGCTGG - Exonic
1141615801 16:85208752-85208774 TAGCGGATGGGGGTGGGGGTGGG + Intergenic
1141903152 16:87006028-87006050 TAGCGGTGGCAGGTGGTGACAGG - Intergenic
1141964768 16:87434444-87434466 CAGCGAAGGCTGGTGGAGGAAGG - Intronic
1142091127 16:88210863-88210885 CAGTGGGGGCTGGTGGGGGGTGG - Intergenic
1142284865 16:89167593-89167615 CAGTGGAGGCGGGTGGGGGAAGG - Intergenic
1142284983 16:89167981-89168003 GAGGGGCTGCTGGTGGGGGCGGG - Intergenic
1142444904 16:90130250-90130272 TAGGTGGTGCTGGTGGGGGCTGG + Intergenic
1142462607 17:105216-105238 TAGGTGGTGCTGGTGGGGGCTGG - Intergenic
1143614145 17:8039557-8039579 TACCAGTGGCTGGAGGGGGCGGG + Exonic
1143617826 17:8064191-8064213 TACCAGTGGCTGGAGGGGGCAGG + Intergenic
1143854254 17:9836996-9837018 TAGCCGAGTGTGGTGGGGGTGGG - Intronic
1143861771 17:9896626-9896648 TTGAGGAGGCAGTTGGGGGCCGG + Exonic
1144334482 17:14256527-14256549 TACAGCAGACTGGTGGGGGCAGG - Intergenic
1144571680 17:16403942-16403964 TAGCGGGGCGTGGTTGGGGCGGG + Intergenic
1144716608 17:17440524-17440546 AAGGGGAGGCTGGTGCTGGCTGG + Intergenic
1145190105 17:20832956-20832978 TACCAGAGGCTGGAGGAGGCAGG + Intergenic
1145401304 17:22536825-22536847 TACCAGAGGCTGGAGGAGGCAGG + Intergenic
1145885732 17:28381327-28381349 TGCCAGAGGCTGGTGGCGGCCGG + Exonic
1146961680 17:36985687-36985709 TAGCTGAGGGTGGTGGTGGGTGG - Intronic
1146969114 17:37058055-37058077 TACCGGAGGCTGAGGGGGGTGGG + Intergenic
1147387799 17:40092094-40092116 GAGAGGCGGGTGGTGGGGGCGGG - Intronic
1147429527 17:40362992-40363014 TCGCGGAGGCTGGCCGGCGCCGG + Exonic
1148132440 17:45270339-45270361 CAGAGGAGGCAGGTGGGCGCAGG - Intronic
1148214159 17:45825367-45825389 TAGCGGGAGGTGGTGGGGGGAGG - Intronic
1148356850 17:46980998-46981020 TAGCGAAGGGGGGTGGGGGCAGG + Intronic
1148549802 17:48543713-48543735 TGCCGGAGGCTGGTGGCGGCGGG - Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148746221 17:49919922-49919944 CAGGTGAGCCTGGTGGGGGCTGG - Intergenic
1148763596 17:50022672-50022694 TTGGGGAGGAAGGTGGGGGCCGG - Intergenic
1149568206 17:57654080-57654102 TAACCCAGGCTGGTGTGGGCAGG - Intronic
1149867170 17:60157373-60157395 TAGAGGAGGCTGAGGGAGGCTGG + Intronic
1150492454 17:65583874-65583896 CCCAGGAGGCTGGTGGGGGCTGG + Intronic
1151174291 17:72274384-72274406 TGTGGGAGGATGGTGGGGGCAGG + Intergenic
1151510729 17:74557875-74557897 TAGAGGAGGCTGGAGGGGAGAGG + Intergenic
1151599252 17:75096281-75096303 TAGCTGAGGGTGGTGTGGCCGGG - Intronic
1151911257 17:77084855-77084877 GAGAGGAAGCAGGTGGGGGCAGG - Intergenic
1152157790 17:78646236-78646258 TAGCGAAGGGTGGTGGGACCTGG + Intergenic
1152250720 17:79211310-79211332 TGGCGGAGGCTGGCGTTGGCAGG - Intronic
1152356648 17:79810798-79810820 TGGCGGAGGGGGGTGGGGGGGGG - Intergenic
1152565239 17:81097417-81097439 TAGTGGAGGCTTGCGGGGGTAGG + Intronic
1152576179 17:81142102-81142124 TAGCCGAGGGTGATGGTGGCAGG - Intronic
1152818778 17:82425022-82425044 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818811 17:82425157-82425179 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818814 17:82425167-82425189 TGGAGGAGGCTGGAGGAGGCCGG + Intronic
1152818823 17:82425197-82425219 TGGAGGAGGCTGGAGGAGGCTGG + Intronic
1152936698 17:83142395-83142417 TACCAGAGGCTGGGTGGGGCTGG + Intergenic
1153220384 18:2855587-2855609 AAGGGGAGGCAGGTGGGGCCAGG + Intronic
1153786219 18:8537553-8537575 TGGAGCAGGCTGCTGGGGGCAGG - Intergenic
1156449939 18:37261225-37261247 TGGGGGGGGCTGGAGGGGGCTGG - Intronic
1156498479 18:37541632-37541654 TGGGAGGGGCTGGTGGGGGCAGG - Intronic
1157306076 18:46518661-46518683 GAGCAGAGGCTGGTGAGGTCGGG - Intronic
1157490818 18:48122566-48122588 CAGCTGAGGCTGGTGAGGGCTGG + Intronic
1157903797 18:51547369-51547391 TACTGGAGGCTGGGGGGTGCAGG - Intergenic
1158083715 18:53625655-53625677 AAGCGTAGGCTGATAGGGGCAGG + Intergenic
1158585947 18:58735063-58735085 TACCAGAGGCTGGGGGGGGGTGG - Intronic
1160330206 18:77984349-77984371 GAGCAGAGGCTGGTGTGGGACGG - Intergenic
1160534392 18:79584519-79584541 TAGACGAGGCTTTTGGGGGCAGG - Intergenic
1160540236 18:79617170-79617192 TTGCGGGGGCTGGGGGCGGCCGG - Intergenic
1160652312 19:237592-237614 TAGGTGGTGCTGGTGGGGGCTGG - Intergenic
1160785378 19:897926-897948 AAGGGGAGGCCGGTGGGAGCTGG - Intronic
1160837465 19:1131625-1131647 GAGCGGAGGCTGGGTGGGCCTGG - Intronic
1161041198 19:2111546-2111568 AAGCCGAGCCTGGCGGGGGCAGG - Intronic
1161106174 19:2445165-2445187 TTGCAAAGGCTGGTGGGGGCAGG - Intronic
1161267108 19:3369499-3369521 GAGCCGAGGCTGGCGGGGGGTGG + Intronic
1161711386 19:5850460-5850482 TTGCGGAGGCTGAGGTGGGCAGG + Intronic
1161977196 19:7613203-7613225 GGGCGGGGGCGGGTGGGGGCGGG + Intronic
1162001012 19:7745097-7745119 TGGGGGAGGCTGGTCAGGGCTGG + Intronic
1162004169 19:7766629-7766651 TGGGGGAGGCTGGTCAGGGCTGG - Intronic
1162022467 19:7874106-7874128 CAGGGGAGGCCGATGGGGGCTGG - Intronic
1162549665 19:11351492-11351514 GACAGGTGGCTGGTGGGGGCGGG + Intronic
1162959306 19:14117008-14117030 TGGCGGGGGCTGGAGGGGGGAGG + Intronic
1163126761 19:15248417-15248439 TAGAGGAGGCGGGTGGGGTGAGG + Intronic
1163144691 19:15372602-15372624 TGTCGGGGGCTGGTGGGGGCGGG + Intronic
1163364555 19:16868784-16868806 TGGAGCAGGCTGGTGGGAGCTGG + Intronic
1163530809 19:17847885-17847907 TGGGGGAGGATGGTGGTGGCGGG - Intronic
1164617765 19:29677019-29677041 TAGAGGAGGCTGGTGGTGGCCGG - Intergenic
1165068770 19:33243279-33243301 TAGCCGAGGCTGGTCCTGGCTGG + Intergenic
1165103989 19:33457948-33457970 GAGCCGAGGGTGCTGGGGGCGGG - Intronic
1165948455 19:39459083-39459105 TGGTGGGGGCAGGTGGGGGCAGG + Intronic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1166317849 19:41998795-41998817 GAGCGGAGACTGCTGGGGCCTGG + Exonic
1166662671 19:44657475-44657497 TGGAGGCGGCTGCTGGGGGCCGG + Intronic
1166794638 19:45419189-45419211 TAGCGGAGGCTGGTGGGGGCAGG + Exonic
1166996438 19:46721861-46721883 TGGGGGAGGCTGGTCTGGGCGGG - Intronic
1167080709 19:47274732-47274754 GGGCGGAGGCTGGAGGGGGTGGG + Exonic
1167080754 19:47274856-47274878 GGGCGGGGCCTGGTGGGGGCGGG + Exonic
1167149691 19:47701725-47701747 TAGCGGGGGGTGGCGGGGGCTGG - Exonic
1167322739 19:48806527-48806549 TAGTGGAGGCTGGAGGAGGCTGG + Exonic
1167527607 19:49994706-49994728 CAGCGGAGGGGGGTGGGGGCCGG + Intronic
1167636083 19:50656566-50656588 AAGGGGAGGCTGAGGGGGGCAGG + Intronic
1168339316 19:55614478-55614500 CAGCGGCGGGAGGTGGGGGCCGG - Exonic
1168564969 19:57415116-57415138 CAGTGGAGGTTGGTGGTGGCTGG + Intronic
925362719 2:3290642-3290664 AAGAGGAGGGTGCTGGGGGCAGG + Intronic
925746644 2:7049169-7049191 CAGCGGGGGCTGTTGGGGGATGG + Intronic
925886810 2:8400662-8400684 TCAGGGAGGCGGGTGGGGGCGGG - Intergenic
926687802 2:15711414-15711436 TGGCGGAGGCTGATGGGTACTGG + Intronic
927190007 2:20511083-20511105 TTTAGGAGGCTGGTGGAGGCTGG - Intergenic
927769751 2:25849295-25849317 TAGCTGGGGGTGGTGGTGGCTGG + Intronic
928320222 2:30277444-30277466 TAGGGGATGCTGGGTGGGGCTGG + Intronic
928375609 2:30770823-30770845 CAGAGGAGAGTGGTGGGGGCAGG + Intronic
929075702 2:38077149-38077171 CAGCCGAGGGTGGTGGCGGCCGG - Intronic
929551893 2:42898910-42898932 TTGTAGAGACTGGTGGGGGCAGG - Intergenic
929828088 2:45325805-45325827 TAGGGGAGGTTGGTGTGGGGAGG + Intergenic
929860331 2:45671583-45671605 GAGAGAAGGCTGGTGGGGGGAGG - Intronic
930730670 2:54724895-54724917 CAGCGGATGATGGTGGCGGCCGG + Exonic
931356178 2:61538873-61538895 TGGCGGGAGCCGGTGGGGGCGGG - Intergenic
931713241 2:65007516-65007538 TAGAGGAGGCTGGTGGCAGGTGG - Intronic
932705006 2:74017396-74017418 TATCAGAGGCTGGGGAGGGCAGG - Intronic
934517080 2:94995420-94995442 GAGCTGAGGTTGGTGGGGTCAGG - Intergenic
934529753 2:95077372-95077394 TTGCGGAGGCTTGTGGGGAGGGG - Intergenic
934562197 2:95319225-95319247 GTGCGGAGGCTGGTGGAGCCGGG + Intronic
934563948 2:95328158-95328180 CTGGGGAAGCTGGTGGGGGCTGG - Intronic
936160239 2:110079330-110079352 GAGCTGAGGTTGGTGGGGTCAGG + Intergenic
936184425 2:110292024-110292046 GAGCTGAGGTTGGTGGGGTCAGG - Intergenic
937137147 2:119563536-119563558 GGGAGGAGGCAGGTGGGGGCAGG - Intronic
937248358 2:120508625-120508647 GAGCAGATGTTGGTGGGGGCGGG + Intergenic
937986262 2:127639521-127639543 TAGGAGAGGCTGGTGTGGGGAGG - Intronic
937991489 2:127664623-127664645 AAGCTGAGGCTGGCGGGGGTTGG + Intronic
938789329 2:134662946-134662968 TAGCTGTGGCTGGTGGGAACTGG - Intronic
939187268 2:138875973-138875995 TACCGGGGCCTGTTGGGGGCTGG - Intergenic
939989154 2:148861107-148861129 AAGCAGAGGCTGCTGGTGGCAGG + Intergenic
941056285 2:160792723-160792745 TACCGGAGGCTGGAGAGGGAGGG + Intergenic
941769559 2:169330199-169330221 TTGGAGAGGATGGTGGGGGCTGG - Intronic
944019638 2:195086715-195086737 TAGCAGAGGGTGATGGGGACTGG - Intergenic
944845483 2:203663955-203663977 TTGGGGAGGCTGAAGGGGGCAGG - Intergenic
945902101 2:215550249-215550271 TAGCAGATGCTGGTGAGGCCTGG + Intergenic
946236934 2:218330024-218330046 AAGCTCAGGCTGGTGGGGCCTGG - Intronic
947575394 2:231269862-231269884 TAGGGGGGGAGGGTGGGGGCGGG - Intronic
947749134 2:232523758-232523780 TGGAGGAGGCTGCTGCGGGCGGG - Exonic
947820905 2:233068842-233068864 TGACGGAGGCTGCTGGGGACAGG + Intronic
948034576 2:234847716-234847738 TAGCTGATGCTGGTGGTGGCAGG - Intergenic
948456077 2:238105239-238105261 AAGTGGAGGAAGGTGGGGGCTGG - Intronic
948462772 2:238138415-238138437 TTGGGCTGGCTGGTGGGGGCAGG - Intergenic
948595496 2:239076885-239076907 TAGAGGAGGCTGAAGGGTGCTGG - Intronic
948891981 2:240911667-240911689 GAGAGTAGGATGGTGGGGGCTGG - Intergenic
1168928799 20:1604674-1604696 GAGTGGAGGGTGGTGGGGGGTGG + Intronic
1168969580 20:1921758-1921780 GAGTGGAGGGTGGTGGGGGGTGG - Intronic
1169204622 20:3732753-3732775 TCGCGGCGGCTGGACGGGGCTGG + Exonic
1169733541 20:8812403-8812425 GAGCGGGGGCTGGTGTGAGCGGG + Intronic
1169733546 20:8812419-8812441 GAGCGGGGGCTGGTGTGAGCGGG + Intronic
1171325205 20:24285095-24285117 TGAGGGAGGCTGGTGGGGCCTGG - Intergenic
1172028869 20:31968001-31968023 CAGCTCAGGCGGGTGGGGGCGGG + Exonic
1172062094 20:32193566-32193588 TGGCAGAGGCTGGAGGTGGCAGG + Exonic
1172125137 20:32621182-32621204 CAGAGGAGGCTGGTGTGGGTTGG + Intergenic
1172342302 20:34168050-34168072 TAGCCGAGCGTGGTGGTGGCGGG - Intergenic
1173654566 20:44690696-44690718 TGGAGGAGGCTGGCGGGGGTGGG + Intergenic
1174094423 20:48076880-48076902 TAGCTGGGGTTGGTGTGGGCGGG + Intergenic
1174442338 20:50566165-50566187 TAGGGGAGGCTGATGGGGGAGGG + Intronic
1174590784 20:51642968-51642990 TTGCAGAGGCCTGTGGGGGCTGG - Intronic
1175492280 20:59387246-59387268 GAGAGGAGGCTCGGGGGGGCTGG + Intergenic
1175936724 20:62517631-62517653 TGGGGGAGGCTGTGGGGGGCAGG - Intergenic
1175970487 20:62684439-62684461 CAGCGTAGCCTGGTGGGGGTTGG - Intronic
1175998573 20:62822003-62822025 GAGTGGGGGCTGGTGGGAGCTGG + Intronic
1176135183 20:63519442-63519464 GTGCAGAGGCTGGCGGGGGCGGG - Intergenic
1176289250 21:5035536-5035558 CTGCTGAGGGTGGTGGGGGCCGG - Intronic
1176312189 21:5157980-5158002 TAGGGGAGGCGGGTGGGGGAGGG - Intergenic
1178942144 21:36915073-36915095 TAGCTGAGGATGGTGGGGCGGGG - Intronic
1179069654 21:38059765-38059787 TTGAGGAGGCTGGTGGTGGGAGG + Intronic
1179485125 21:41705166-41705188 AAGCCGAGGGTGGTGGGGGGAGG + Intergenic
1179844859 21:44104050-44104072 TAGGGGAGGCGGGTGGGGGAGGG + Exonic
1179867985 21:44228068-44228090 CTGCTGAGGGTGGTGGGGGCCGG + Intronic
1180138307 21:45875579-45875601 TGGGGGAAGCTGGTGTGGGCAGG - Intronic
1180376478 22:12098120-12098142 CAGCGGACCCTGGCGGGGGCTGG + Intergenic
1180877165 22:19179933-19179955 TAGGGGAAGCTGGCAGGGGCTGG + Exonic
1181049081 22:20230300-20230322 TAGGAGGGGCTTGTGGGGGCAGG + Intergenic
1181545651 22:23600628-23600650 GAGGGGAGGCTAGTGGGGGTGGG - Intergenic
1181814659 22:25429270-25429292 GAGGGGAAGCTGGTGGGGGTGGG + Intergenic
1182378651 22:29868364-29868386 TCTCAGAGGCTGGTGGGGGTGGG + Intergenic
1183082062 22:35463051-35463073 TAGGGGTTGGTGGTGGGGGCAGG - Intergenic
1183377778 22:37475057-37475079 TAGGGGCTGCTGTTGGGGGCAGG - Intronic
1183513058 22:38247071-38247093 CAGAGGAGGCTGATGTGGGCTGG - Intronic
1183725973 22:39589965-39589987 TCTGGGAGGCTGGTGGGGGCGGG - Intronic
1184286303 22:43473637-43473659 CAGCTGAGGCTGGTGGGGAGTGG + Intronic
1184645116 22:45891256-45891278 TAGCAGAGGCTGTGGGGGGCCGG - Intergenic
1184676693 22:46046864-46046886 TAGCGCTGGCAGGTGGAGGCAGG - Intergenic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184920207 22:47600629-47600651 GAGCAGAGGCTGGGAGGGGCGGG - Intergenic
1185150799 22:49162909-49162931 CGGCGGAGGCTCGTGGTGGCAGG + Intergenic
1185331554 22:50254277-50254299 TAGCGGGGGCTGGGGGAGACAGG + Intronic
1185421221 22:50735408-50735430 TCACGGAGGGTGGTGGGGACAGG + Intergenic
949809054 3:7986186-7986208 CAGCAGAGGCTGATGGGGTCTGG + Intergenic
950097431 3:10338152-10338174 TACAGGAGGCTCTTGGGGGCTGG - Intronic
950097635 3:10339173-10339195 TACAGGAGGCTCTTGGGGGCTGG - Intronic
950404700 3:12797176-12797198 TCGCTGAAGGTGGTGGGGGCGGG - Intronic
951109460 3:18784997-18785019 GAACAGAGGATGGTGGGGGCGGG + Intergenic
952492115 3:33882749-33882771 AAGCGTGGGGTGGTGGGGGCAGG - Intergenic
952550828 3:34475118-34475140 TACCAGAGGCTGGTGGTGGAGGG - Intergenic
952635897 3:35530288-35530310 GGGTGGAGGGTGGTGGGGGCTGG + Intergenic
953030628 3:39177698-39177720 TAGCGGGGGCGGGGGGGGGAGGG + Intergenic
953422154 3:42762463-42762485 CAGGGTAGGCTGGAGGGGGCTGG + Intronic
953717728 3:45330292-45330314 AAGCGAAGGCTGGTGCTGGCTGG + Intergenic
954223222 3:49166958-49166980 TTGCTCAGGCAGGTGGGGGCAGG + Intergenic
954708445 3:52493487-52493509 CTGAGGTGGCTGGTGGGGGCCGG + Intergenic
954738909 3:52730865-52730887 TGCCAGGGGCTGGTGGGGGCAGG + Intronic
954891504 3:53934431-53934453 TAGTAGAGACTGGTGGAGGCGGG + Intergenic
954979136 3:54727752-54727774 TGTCAGTGGCTGGTGGGGGCAGG + Intronic
955579804 3:60406662-60406684 TAGAGAAGGATGGTGGGGGGTGG + Intronic
957733249 3:84170548-84170570 GAGAGGAGGCAGGTAGGGGCTGG - Intergenic
959546163 3:107599032-107599054 GAGCGGGGGCTGGTGGGAGGTGG + Intronic
959992369 3:112643492-112643514 TGGGGGAGGGTGGTGGGGGTTGG + Intronic
961168414 3:124779402-124779424 TTGGGGAGGCTGGTGGTGGGAGG - Intronic
961344586 3:126255788-126255810 TTGCGGAGGGTAGTGGGGGGTGG - Intergenic
961482932 3:127195711-127195733 GAGCGGAGGCTGGTGCGGTCAGG - Intronic
962126367 3:132623990-132624012 TGGGGGAGGGTGGTGGGGGGTGG - Intronic
962272980 3:133991726-133991748 GAGGGGAGGCTGCAGGGGGCCGG + Intronic
962948990 3:140200800-140200822 AAGAGGAGGCAGGTGGGGGAGGG - Intronic
963248179 3:143082161-143082183 TATAGGAGGCTGAGGGGGGCAGG - Intergenic
963556531 3:146796001-146796023 TGGCGGGGGGTGGTGGGGGAGGG + Intergenic
964714765 3:159710366-159710388 TACCAGAGGCTGGTTGGGGAGGG + Intronic
966919392 3:184602070-184602092 GAGGGGAGGCTGGGGGCGGCGGG + Intronic
968365521 3:198182380-198182402 TAGGTGGTGCTGGTGGGGGCTGG + Intergenic
968434190 4:576411-576433 TGGCGGGGGCTGCCGGGGGCGGG - Intergenic
968613612 4:1567787-1567809 GAGGGGAGGCTGGAGGGGCCGGG - Intergenic
968629137 4:1641277-1641299 CAACTGAGGCTGGTGGGGGCTGG - Exonic
968890622 4:3366738-3366760 TAGCAGAGACTGGTGTGGGTGGG + Intronic
968958352 4:3730421-3730443 GGGCGGGTGCTGGTGGGGGCTGG + Intergenic
968958389 4:3730499-3730521 TGGGGGGTGCTGGTGGGGGCTGG + Intergenic
969221091 4:5759062-5759084 TTGTGGAGGGCGGTGGGGGCGGG + Intronic
969238006 4:5880208-5880230 GAGGGGAGAATGGTGGGGGCAGG + Intronic
969279263 4:6158618-6158640 TAGCTGGGGCTGGTGGGGGTGGG - Intronic
969415157 4:7053113-7053135 GGGCAGAGGCAGGTGGGGGCTGG + Intronic
971327910 4:25658917-25658939 GAGGGGAGGGTGGTGGGGGTGGG - Intronic
980291525 4:130852044-130852066 GAGCGGAGGCTGGAAGAGGCAGG - Intergenic
983236891 4:165189653-165189675 TAGGGGGGGATGGTGTGGGCAGG + Intronic
984795803 4:183659158-183659180 GAGCCGCGGCTGGTGGGGCCTGG + Exonic
1202758078 4_GL000008v2_random:83553-83575 CAGCGGACCCTGGCGGGGGCTGG + Intergenic
985541260 5:488744-488766 GAACGGAGGCAGGTGGGTGCAGG + Intronic
985648816 5:1098134-1098156 TTGCAGAGGGTTGTGGGGGCTGG - Intronic
985733923 5:1566329-1566351 CAGGGGAGGCTGTCGGGGGCAGG + Intergenic
985824740 5:2183833-2183855 GCGGGGAGGCTGCTGGGGGCGGG + Intergenic
985886578 5:2684813-2684835 TTGGGGAAGATGGTGGGGGCCGG - Intergenic
986177562 5:5365002-5365024 CAGCGGGGGCTGCTGGGGGCAGG + Intergenic
987294521 5:16538156-16538178 TAGCTGTGGCAGGTGGGGTCCGG - Intronic
987398894 5:17454240-17454262 TAAAGGAGGCTGGTGGGAACTGG + Intergenic
990184824 5:53201576-53201598 AAGAGGAGGCTGGCGGGGGGCGG - Intergenic
991956258 5:71998398-71998420 CAGCAGAGGCTGGTGGAGGAAGG + Intergenic
992089760 5:73306514-73306536 TAGAGGAGCATGGTGGGGCCAGG + Intergenic
992343338 5:75849040-75849062 TAGAAGGGGCTGGTGGGGGTGGG - Intergenic
992910722 5:81393918-81393940 GAGCGGCGGCGGCTGGGGGCTGG - Intronic
993597710 5:89880386-89880408 TAGCTGGGGCAGGCGGGGGCAGG - Intergenic
994877222 5:105439632-105439654 TTGGGGAGGGTGGTGGAGGCTGG + Intergenic
995833545 5:116378594-116378616 TAATGGAGGCAGGTTGGGGCAGG - Intronic
996398400 5:123035631-123035653 AAGCTGAAGCTGGAGGGGGCGGG - Intronic
996974893 5:129420055-129420077 TAGCAGAGGCTGTAGGGGGTGGG + Intergenic
997466367 5:134090623-134090645 GAGCGGAGGTTGGTGGGAGCAGG - Intergenic
997705868 5:135951972-135951994 TAGGGGAGGCTGGTGAGAGCAGG - Intronic
998079516 5:139262871-139262893 AGGCTGAGTCTGGTGGGGGCTGG + Intronic
998164767 5:139836727-139836749 GAGAGGAGGCTGGTGGGGAAAGG + Intronic
998885239 5:146687055-146687077 TAGCGGGGAGTGGTGGGGGGAGG + Intronic
999082165 5:148854997-148855019 TGGTAGAGGCTGGTGGGAGCTGG + Intergenic
999197991 5:149795769-149795791 TTGGGGATGATGGTGGGGGCAGG + Intronic
1000318931 5:160118774-160118796 GACCGGAGGGTGCTGGGGGCGGG + Intronic
1001106818 5:168861405-168861427 TTGGGCGGGCTGGTGGGGGCGGG - Intronic
1002487867 5:179551667-179551689 TATGGGAGGGGGGTGGGGGCGGG - Intronic
1002648510 5:180674168-180674190 TAGCGGAGGCTGGTCCCTGCCGG - Intergenic
1002944609 6:1749440-1749462 TAGCTGGGCGTGGTGGGGGCGGG + Intronic
1003377493 6:5593293-5593315 CAGCAGAGGCCGGTGGGGGCGGG - Intronic
1003866557 6:10368650-10368672 CAGCAGAGGCTGGTGGGAACTGG - Intergenic
1004009065 6:11663920-11663942 TAGGGGAGGCGGGCGGGGGGCGG + Intergenic
1004176666 6:13346103-13346125 AAGGTGGGGCTGGTGGGGGCTGG + Intergenic
1005138191 6:22596053-22596075 GAGCAGGTGCTGGTGGGGGCAGG - Intergenic
1006155401 6:32010612-32010634 TGGCCGAGGATGGAGGGGGCAGG - Intergenic
1006161707 6:32043346-32043368 TGGCCGAGGATGGAGGGGGCAGG - Intronic
1006498236 6:34439804-34439826 TGGCAGAGGCTGGGGGGGGGTGG - Intergenic
1006581416 6:35079739-35079761 CAGCGGAAGATGCTGGGGGCTGG + Intronic
1007758081 6:44113895-44113917 TTGCGCAGGCTGGTGGGGATGGG + Exonic
1011662558 6:89606851-89606873 TCGTGGGGGCAGGTGGGGGCGGG + Intronic
1012534880 6:100283511-100283533 CAGCAGAGGCTGCTGGAGGCTGG - Intergenic
1013047516 6:106502064-106502086 TAGCTGTGCCTGGTCGGGGCAGG + Intergenic
1015988689 6:138912566-138912588 TATCAGAGTCTGGTGGGGGTGGG - Intronic
1016460354 6:144275020-144275042 AAGTGGAGGGTGGTGGGGACAGG - Intergenic
1016934081 6:149436117-149436139 TGGGGGAGGCCGGTGGCGGCTGG + Intergenic
1019450673 7:1096121-1096143 CAGCGGTGTCTGGTGCGGGCAGG - Intronic
1019687127 7:2388186-2388208 TGAGGGAGGCTGGTGGGTGCTGG + Intergenic
1020755547 7:12197984-12198006 CAGAGGAGGCTGGTGGGAGAAGG - Intergenic
1021231050 7:18086730-18086752 CCGCGGAGGCTGGGCGGGGCTGG - Intergenic
1022230799 7:28410260-28410282 CAGCGGAGGCAGGAGGCGGCCGG - Intronic
1023814592 7:43939843-43939865 TACCTGAGGCTGATGGGGGGTGG + Intronic
1023969241 7:44979061-44979083 TGGAGGAGGCTGGTGGGGCAGGG - Exonic
1024095223 7:45977433-45977455 TAGTGCAGGGTGGTGGGTGCCGG + Intergenic
1024634419 7:51275631-51275653 TGGTGGCGGCTGGTGGTGGCTGG - Intronic
1024634428 7:51275661-51275683 TGGTGGTGGCTGGTGGCGGCTGG - Intronic
1026271546 7:68841448-68841470 TGGAGGTGGCTGGTGGGGGTGGG - Intergenic
1026312228 7:69196437-69196459 TAGTGGAGGCTGGAGGGAGGGGG - Intergenic
1026927077 7:74201856-74201878 TAGTAGAGGCTTGTGGGGGGAGG - Intronic
1026944647 7:74307806-74307828 TACTGGAGGCTGCTGGGGGGTGG + Intronic
1027374891 7:77538528-77538550 TGGCGGAGGCGGGGGGGCGCTGG - Intronic
1028026270 7:85844354-85844376 TATCAGAGGCTGGAGGGGGTGGG + Intergenic
1028412296 7:90543100-90543122 TACCAGAGGCTGGAGTGGGCAGG + Intronic
1029150126 7:98474372-98474394 TAGCAGAGCGTGGTGGGGGTGGG + Intergenic
1029537107 7:101163330-101163352 GAGCGGACGTGGGTGGGGGCGGG + Exonic
1029633716 7:101769746-101769768 CAGGGGAGGATGGTGGTGGCTGG - Intergenic
1031417386 7:121509909-121509931 GAGCGGACGCTGGTGGAGGAAGG + Intergenic
1032215345 7:129952889-129952911 TAGTGGAGGCTGCTAGGAGCCGG - Exonic
1032389853 7:131548840-131548862 AAGAGGTGGCAGGTGGGGGCCGG - Intronic
1033064977 7:138145782-138145804 AAGCGGGGGCTGGTGGAGGGGGG + Intergenic
1033333798 7:140435625-140435647 CAGCGGCGGCTCGTGGGGGACGG - Intergenic
1033338028 7:140469814-140469836 TTTGGGAGGCTGGTGTGGGCTGG + Intronic
1034051412 7:147988083-147988105 AAGCGGAGGGTGGTGGGGGTAGG + Intronic
1034847563 7:154460988-154461010 TAGTGGTGGATGGTGGGGGTGGG - Intronic
1035600606 8:894837-894859 GAGTGGAGGCTGGCAGGGGCGGG + Intergenic
1035635115 8:1138509-1138531 TAGAGCAGGCTGGGGTGGGCTGG + Intergenic
1035768341 8:2126770-2126792 TAGGAGAGGCTGATGGAGGCTGG + Intronic
1036203661 8:6789909-6789931 AGGCGGAGGGTGGTGGCGGCGGG + Intergenic
1036213768 8:6863160-6863182 TGGGGGAGGCTGGTGGGGAGTGG + Intergenic
1036213869 8:6863470-6863492 TTGGGGAGGCTGGTGGGGATTGG + Intergenic
1036565349 8:9933745-9933767 GAGCAGAGGCGGGAGGGGGCGGG - Intergenic
1037684717 8:21129133-21129155 TAGAGGAGGGTTTTGGGGGCGGG - Intergenic
1037763967 8:21760346-21760368 TAGTGGAGGCTGGGGTGGGGTGG + Intronic
1037837360 8:22222001-22222023 TAGTGGAGGCGGCTGGGGGAGGG - Intronic
1037920418 8:22801788-22801810 GAGCGGAGTTTGGTGGGGGAGGG - Intronic
1038239415 8:25794849-25794871 TAGGGCACACTGGTGGGGGCGGG - Intergenic
1038341154 8:26686103-26686125 TGGCTGAGGCTGAGGGGGGCAGG + Intergenic
1038421073 8:27434356-27434378 CAGCCCAGGCTGCTGGGGGCTGG - Intronic
1039441910 8:37600947-37600969 TAGCAGAGGCTACTGAGGGCCGG - Intergenic
1039883967 8:41645275-41645297 TGGGGGAGGCGGGTGAGGGCTGG - Exonic
1040389831 8:46940481-46940503 CAGTGGAGGGTGCTGGGGGCTGG + Intergenic
1041792656 8:61714380-61714402 CCGCGGGGGCTGGTGAGGGCTGG + Exonic
1042217024 8:66437536-66437558 TGGGGGAGGGGGGTGGGGGCAGG - Intronic
1043284898 8:78516342-78516364 GAGCGGAGGCTGCTGCTGGCAGG + Exonic
1043540295 8:81254856-81254878 TAGTGGAGGCTGCTAGGAGCCGG + Intergenic
1043997942 8:86842684-86842706 TAGCGGGGGTTGGCGGGGGGGGG + Intergenic
1045662541 8:104453028-104453050 TGGGGGAGGGTGGTGGGGGCCGG - Intronic
1047676180 8:127205758-127205780 TAGCAGTGGCGGGCGGGGGCCGG + Intergenic
1047916871 8:129592416-129592438 GAGGGGAGGATGGTGGGGGTGGG + Intergenic
1047929620 8:129713724-129713746 TATTGGGGGATGGTGGGGGCAGG - Intergenic
1048480406 8:134785491-134785513 TGGCGGAGGGGGGAGGGGGCGGG - Intergenic
1049002050 8:139832463-139832485 CAGGGGAGGCTGGTGGGGGTGGG + Intronic
1049163484 8:141112259-141112281 GAGCGGAGGCTGAGGGGGTCAGG + Intergenic
1049316810 8:141973662-141973684 GAGCGCAGGCTCGTGAGGGCAGG - Intergenic
1049581498 8:143413230-143413252 TGGCGGAGGGTGGTGGAGGGTGG - Intergenic
1049613676 8:143567304-143567326 CGGCGAAGACTGGTGGGGGCCGG + Exonic
1049615869 8:143575637-143575659 CAGGGAAGGCTGTTGGGGGCAGG + Exonic
1049710427 8:144060711-144060733 GAGGCGAGGCTGGTGCGGGCAGG - Intronic
1049745207 8:144260371-144260393 CAGTGTAGGCTGGTTGGGGCAGG + Exonic
1051058775 9:13021220-13021242 TACCAGAGGCTGGTGGGGGGGGG + Intergenic
1053009968 9:34627592-34627614 TTGCAGAGGGTGGTGGGGGTGGG + Intronic
1053159010 9:35800655-35800677 GGGAGGAGGCTGGTGGGAGCAGG + Intronic
1055374960 9:75638283-75638305 CAGCCCAGGCTAGTGGGGGCTGG + Intergenic
1055840855 9:80501370-80501392 TAGTTGAGGCAGGTGGGTGCAGG - Intergenic
1056206114 9:84320842-84320864 TAGCCGAGGGTGGTGGTGGGAGG + Intronic
1056560029 9:87722068-87722090 TGGAGGATGCTGGTGGAGGCTGG + Intergenic
1059455741 9:114398887-114398909 TAGTAGAGACTGGTGGGGGTGGG - Intergenic
1059811301 9:117858449-117858471 TAGAGGAGACAGGAGGGGGCAGG - Intergenic
1060995889 9:127874765-127874787 CAGAGGGGGCTGCTGGGGGCAGG + Intronic
1061489126 9:130935510-130935532 TAGCTGAGGCTGGATAGGGCTGG + Intronic
1062025544 9:134338612-134338634 TGCCGGCTGCTGGTGGGGGCAGG + Intronic
1062059256 9:134486191-134486213 TGGCAGAGGCTGGTGGGGCCTGG + Intergenic
1062180176 9:135187085-135187107 TGGAGGTGGCTGGTGGGGTCAGG - Intergenic
1062221667 9:135419363-135419385 CAGTGGAGGGTGGTGAGGGCTGG - Intergenic
1062295755 9:135825620-135825642 TGGCAGAGGCTGCTGGGTGCCGG - Intronic
1062431910 9:136530077-136530099 GAGCGGCGGCTGTTTGGGGCTGG - Intronic
1062459154 9:136655661-136655683 TAGCGGGTTCTGGTGGAGGCGGG - Intergenic
1062600237 9:137316084-137316106 CCGCCGAGGCTGGGGGGGGCCGG - Intronic
1062749889 9:138245247-138245269 TAGGTGGTGCTGGTGGGGGCTGG + Intergenic
1203538867 Un_KI270743v1:68425-68447 CAGCGGACCCTGGCGGGGGCTGG + Intergenic
1189010764 X:37043698-37043720 CAGCGGCGGCTGGTGGAGGGCGG + Intergenic
1189226789 X:39419943-39419965 TGGAGGAGGATGGTGGGGGAGGG - Intergenic
1190993068 X:55572505-55572527 TCGCGGGGGGTGGTGGGGGAAGG + Intergenic
1192272517 X:69595543-69595565 TACCAGAGGCTGGTGGTGGGAGG + Intergenic
1193299077 X:79867796-79867818 TGGCGGGGGGTGGAGGGGGCTGG - Intergenic
1193702002 X:84774377-84774399 TAGAGCAGGCTGGTGGGGAGAGG + Intergenic
1196150710 X:112370285-112370307 TTCAGGAGGCTGCTGGGGGCAGG - Intergenic
1197617113 X:128705520-128705542 TAGCTGAGGCTGGGGAGGGTTGG - Intergenic
1197648604 X:129042116-129042138 TCGCTGAGCCTGGTGGGGGAAGG - Intergenic
1198478887 X:137022607-137022629 TAGAGCAGCCTGGTGGGGGAGGG + Intergenic
1198614991 X:138447308-138447330 TATCAGAGGCTGGTGGGGTTGGG - Intergenic
1198771445 X:140135031-140135053 AAGGAGAGGATGGTGGGGGCAGG + Intergenic
1199078010 X:143546084-143546106 TAGCTGGGGGTGGTGGGGGAGGG + Intergenic
1199861482 X:151804252-151804274 TACCAGAGGCTGGTGGAGGGTGG - Intergenic
1200085107 X:153600197-153600219 TTGGGGAGGCTGGTGGAGGCAGG - Intergenic
1201765510 Y:17570653-17570675 TAGCCGAGGGCGGTGGGGGGCGG + Intergenic
1201836042 Y:18335336-18335358 TAGCCGAGGGCGGTGGGGGGCGG - Intergenic