ID: 1166794671

View in Genome Browser
Species Human (GRCh38)
Location 19:45419355-45419377
Sequence CTTCCAAGAAGATGCTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166794664_1166794671 18 Left 1166794664 19:45419314-45419336 CCTGAGGCCCACAGAGGGTAAGT 0: 1
1: 0
2: 14
3: 97
4: 445
Right 1166794671 19:45419355-45419377 CTTCCAAGAAGATGCTCCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 78
1166794665_1166794671 11 Left 1166794665 19:45419321-45419343 CCCACAGAGGGTAAGTCACTTGC 0: 1
1: 3
2: 25
3: 227
4: 924
Right 1166794671 19:45419355-45419377 CTTCCAAGAAGATGCTCCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 78
1166794666_1166794671 10 Left 1166794666 19:45419322-45419344 CCACAGAGGGTAAGTCACTTGCC 0: 1
1: 5
2: 27
3: 226
4: 985
Right 1166794671 19:45419355-45419377 CTTCCAAGAAGATGCTCCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166794671 Original CRISPR CTTCCAAGAAGATGCTCCGC AGG Intronic
901175184 1:7293740-7293762 GAACCAAGAAGATGCTCCCCAGG - Intronic
903170229 1:21548006-21548028 CTGCCAAGTAGCTGCTCCTCTGG + Intronic
906296245 1:44650754-44650776 CTCACAAGTAGATCCTCCGCAGG - Exonic
910220367 1:84883748-84883770 CTTCCAAAAAGAGGCTCCAGTGG - Intronic
918860650 1:189822034-189822056 TTTCCAAGAATCTGCTCAGCAGG - Intergenic
924295416 1:242582290-242582312 CTTCTAAGAAGATTCTTGGCTGG + Intergenic
1065351691 10:24801444-24801466 CCTCCAAGAAGAAGCTCTGCTGG - Intergenic
1067563642 10:47321553-47321575 ATGCCAAGAAGATGATCCCCTGG - Intergenic
1070401857 10:76059756-76059778 CTTCCATCAAGTTGCTCTGCTGG + Intronic
1073482984 10:103798626-103798648 CCTCCAAGGAGCTGCTCCCCGGG - Intronic
1074135197 10:110619796-110619818 CTGCCTAGAAGATTCTCAGCAGG + Intergenic
1077036393 11:496885-496907 CTTCCAGGAAGATGGACCACAGG + Intronic
1079279259 11:19073068-19073090 CCTCCAAGCCCATGCTCCGCAGG + Intergenic
1082803696 11:57432854-57432876 CTTCCAAGCAGAGGCTCCCAGGG - Intergenic
1088389330 11:109297064-109297086 ATTGTAAGAAGATGCTACGCAGG - Intergenic
1090916755 11:131171334-131171356 CTTCAGAGAAGATGGTCCCCGGG - Intergenic
1091904223 12:4170130-4170152 CTTCCACGATGACTCTCCGCTGG - Intergenic
1102134077 12:110558188-110558210 CTTCCACAAAGATGCCCTGCTGG - Intronic
1106052182 13:26201898-26201920 CTTCCAAGCAGATCCACAGCTGG - Intronic
1117333680 14:54738382-54738404 CTGACAAGAAGCTGCTCCCCTGG + Intronic
1118515350 14:66522012-66522034 CTGCCATGAAAATGCTCCTCTGG + Intronic
1125454441 15:39842960-39842982 ATTCCAAGAAGTTGCTGAGCTGG - Intronic
1127409529 15:58692006-58692028 CTTCCAAGATTTTGCTCTGCTGG + Intronic
1129121452 15:73399334-73399356 CTTCCAAGAATGTCCTCCCCTGG + Intergenic
1134791880 16:16996582-16996604 CTACCAAGAAGATGCTACTTGGG + Intergenic
1135509675 16:23071590-23071612 CTTCCAACATGCTGCTCCCCAGG - Intronic
1139048534 16:63094412-63094434 CTTTAAAGAAGATGGTCCTCGGG + Intergenic
1140272042 16:73474637-73474659 CTTACAAGCAGATGCTCCTCTGG + Intergenic
1140639965 16:76960189-76960211 CTTCCACGAAGAGGCCCTGCAGG - Intergenic
1148756354 17:49975200-49975222 CTTCCCAGGAGATGCTCTCCTGG + Intergenic
1151301922 17:73232833-73232855 GTTCCAGGAAGACCCTCCGCCGG - Intronic
1152601554 17:81264800-81264822 GTTACAAGCAGATGCCCCGCTGG + Intronic
1156279790 18:35625730-35625752 CTTCCCAGAAACTGCTCCCCTGG + Intronic
1161183440 19:2900693-2900715 CTTCCAATCAGGTGCTCCGGGGG + Intergenic
1162721439 19:12665161-12665183 CTTCCCAGAGGATGCACAGCAGG + Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166794671 19:45419355-45419377 CTTCCAAGAAGATGCTCCGCAGG + Intronic
930090334 2:47527202-47527224 CTCCCACGAAGATGCTCCCCTGG - Intronic
932095931 2:68848411-68848433 CTTCCAGGTATATGCTCCACTGG - Intergenic
937448737 2:121982390-121982412 CTTCCAAGAAGATGTGCTCCAGG + Intergenic
938293329 2:130161791-130161813 CCTCCTGGAACATGCTCCGCTGG - Intronic
938463223 2:131511172-131511194 CCTCCTGGAACATGCTCCGCTGG + Intergenic
942896547 2:181062787-181062809 CTTCCAACCAGAGGATCCGCTGG - Exonic
944303492 2:198152510-198152532 CTTTAAAGAAGTTGCTCCACCGG - Intronic
944834079 2:203561251-203561273 TTTCCAATAAGATGTTCTGCTGG + Intergenic
947271382 2:228339681-228339703 CCTTCAAGATGATGCTCCACTGG + Intergenic
1173002155 20:39112115-39112137 CTTCCAAGAAGGTGAACCGTGGG + Intergenic
1174413933 20:50354761-50354783 GTTCCAGGAAGGTGCTCCGTGGG - Intergenic
1175048309 20:56128153-56128175 CTTCCAGGAATATGTTCAGCTGG + Intergenic
1178406431 21:32327311-32327333 CTTTAAAGAAGTTGCTCCTCTGG - Intronic
1180927893 22:19568637-19568659 CCTCCATGGAGATGCTCCCCAGG - Intergenic
1182875782 22:33690069-33690091 CTTCCAAGGGGAAGCTCCGCAGG + Intronic
1185089881 22:48760313-48760335 CTTGCAAGAAGGTGCTACGGCGG + Intronic
952538629 3:34341808-34341830 CTTACATGAATATGCTCAGCTGG - Intergenic
956996332 3:74830178-74830200 CTTCCAAGTCTATGCTTCGCGGG + Intergenic
960288090 3:115852367-115852389 ATTTCAAGCAGATGCTCCTCTGG - Intronic
960472261 3:118081290-118081312 CTACTAAGAAGATGCTCCTTCGG - Intergenic
963511223 3:146251211-146251233 CTTCCAGGAAGACGCTCCCCCGG - Intergenic
967097416 3:186188337-186188359 CTTCCAGGAAGATGTTGCTCAGG + Exonic
972591529 4:40492722-40492744 TTTCCAAGAAAATGCTTCCCTGG + Intronic
974030170 4:56769520-56769542 TTTCCAAGAACATGTTCAGCAGG - Intergenic
976692739 4:87886089-87886111 CATCCGAAAAGATGCTCCCCAGG + Intergenic
987088257 5:14488525-14488547 GTTCCAAGAAGATATTCTGCTGG - Intronic
990818567 5:59812251-59812273 CTTTCAAGGAGATGCTCTTCAGG + Intronic
997766203 5:136506190-136506212 CTTCCAGGAAGATGCCCAACAGG + Intergenic
999524735 5:152392337-152392359 CTGTCAGGAAGATGTTCCGCTGG + Exonic
1003192509 6:3886974-3886996 CTTCCAAGAGGATGCTGCCCAGG - Intergenic
1017604475 6:156119218-156119240 CAGCCAAGAAGATGCACTGCAGG - Intergenic
1023812609 7:43923614-43923636 CTTCAAAGAAGATACTCAACTGG - Intronic
1023859815 7:44211831-44211853 CTTCCTAGAAGATGGTCCTGAGG - Intronic
1024260991 7:47573633-47573655 TTTCCAAGAGGATGCTGGGCTGG - Intronic
1024910749 7:54444356-54444378 CTTCCCAGACGATGGGCCGCCGG - Intergenic
1031643747 7:124198352-124198374 CTTCCTAGAAGATGCTCAAAGGG - Intergenic
1035651972 8:1273338-1273360 CTCCCAAGCAAATGCTCAGCTGG - Intergenic
1036256748 8:7212444-7212466 CTTCCAGGAAGATGTTCTGAGGG + Intergenic
1036308798 8:7671046-7671068 CTTCCAGGAAGATGTTCTGAGGG + Intergenic
1036360743 8:8075065-8075087 CTTCCAGGAAGATGTTCTGAGGG - Intergenic
1036788559 8:11703426-11703448 CCTCCATGAAGAAGCTCCCCTGG + Intronic
1036890225 8:12591907-12591929 CTTCCAGGAAGATGTTCTGAGGG + Intergenic
1049843746 8:144789940-144789962 CCTCCAAAAGGATGCTCCACAGG + Exonic
1051295035 9:15586637-15586659 CTTCCAAGAGCATGCTACTCTGG + Intronic
1055474245 9:76645601-76645623 CTTCCCAGAGGATGCTCAGTAGG - Intronic
1057158114 9:92862759-92862781 CTGCCAAGAAGATGCTGGCCAGG + Intronic
1186241368 X:7570563-7570585 ATTCCAAGGAAATCCTCCGCAGG + Intergenic
1198384524 X:136115993-136116015 CTTGCAAGCAGATGTTCTGCTGG - Intergenic