ID: 1166796235

View in Genome Browser
Species Human (GRCh38)
Location 19:45428012-45428034
Sequence CAAGTTGGCAAGTTGGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166796231_1166796235 -3 Left 1166796231 19:45427992-45428014 CCTGGGTTCTACGTTATTTCCAA 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1166796235 19:45428012-45428034 CAAGTTGGCAAGTTGGATGTTGG 0: 1
1: 0
2: 2
3: 10
4: 130
1166796230_1166796235 -2 Left 1166796230 19:45427991-45428013 CCCTGGGTTCTACGTTATTTCCA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1166796235 19:45428012-45428034 CAAGTTGGCAAGTTGGATGTTGG 0: 1
1: 0
2: 2
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166796235 Original CRISPR CAAGTTGGCAAGTTGGATGT TGG Intronic
902161401 1:14533421-14533443 CAACTTGGCATATTGGATATTGG + Intergenic
904061461 1:27714302-27714324 CAAGATGGGAAGGAGGATGTCGG + Intergenic
906725588 1:48041894-48041916 CAAGAAGGCAAGATGGAGGTTGG - Intergenic
908379138 1:63578091-63578113 CAAGTTGGAAAAATGAATGTGGG + Intronic
909010825 1:70332991-70333013 AGATTTGGCAAGTTGCATGTTGG + Intronic
912498088 1:110104199-110104221 CCAGTTGGCAGGTGGGATGTTGG - Intergenic
913005432 1:114625974-114625996 CCAGTTGGGAACATGGATGTTGG - Exonic
915248551 1:154572543-154572565 CAGGTTAACAACTTGGATGTGGG - Intronic
917732649 1:177891650-177891672 CAGGTTGCCAAGCTGGCTGTGGG - Intergenic
918702689 1:187625215-187625237 CAAGTTGACAAGTTGGATCAAGG - Intergenic
918849054 1:189659970-189659992 CAAGTTGGCAAGCAGTATGATGG - Intergenic
919203448 1:194389898-194389920 CAAGTTGGGAATTTGGATAATGG - Intergenic
919947320 1:202328996-202329018 CAGATTGGCAAGTTGGCAGTGGG + Intergenic
921473095 1:215571590-215571612 CAAATTGTAAAGTTGTATGTGGG + Intronic
921979535 1:221240863-221240885 CAAGTTGGCAAGTGGGATTTAGG + Intergenic
922414597 1:225409339-225409361 CAACTTCGCAAGTTTGATATTGG - Intronic
924055506 1:240120556-240120578 CAAGTTTGCAAGGTAGATGCTGG + Intronic
1063224441 10:4002603-4002625 CCAGTTTGGAACTTGGATGTGGG - Intergenic
1063614172 10:7588008-7588030 CAAGTTGGACAGTGGAATGTGGG - Intronic
1067225485 10:44373445-44373467 CAAGGTGGCAACTTGGAAGTAGG - Intronic
1074420844 10:113307778-113307800 CAAGGTGGCAAGGTGGCAGTTGG - Intergenic
1079999808 11:27334360-27334382 CAAGTGGGCAAGTAGGATGGAGG - Intronic
1080229248 11:30000275-30000297 AAAATTGGCAAGTTGGATTCAGG + Intergenic
1081089505 11:38845873-38845895 CAATATGGGAAATTGGATGTGGG + Intergenic
1082118536 11:48354241-48354263 CGAGTTGCCAAGTGGGATATTGG + Intergenic
1084797981 11:71520955-71520977 CAAGTTGGCAGTTGGGATTTAGG - Intronic
1087487226 11:98771433-98771455 CAAGTTGTCAATATGGATTTTGG + Intergenic
1089039483 11:115433011-115433033 GAACTTGACAAGTTGGATGTTGG - Intronic
1091618408 12:2067191-2067213 CAAGGTGGCCAGTGGGATGCAGG + Intronic
1097412331 12:59270077-59270099 CAAGCTGGCAAATTGGATAAAGG + Intergenic
1097800629 12:63910219-63910241 CAAGTTGTCAAGTTGGATTTTGG - Intronic
1098036681 12:66310346-66310368 TAAGTGGGAAAGGTGGATGTGGG + Exonic
1098797551 12:74910226-74910248 ATAGTTGGCAAGTTGGAAGCAGG + Intergenic
1099817485 12:87668065-87668087 CAAATTGGCAAATTAAATGTGGG + Intergenic
1101560315 12:105851019-105851041 CAAGCAGGCAAGATGGATATGGG + Intergenic
1102603517 12:114051440-114051462 CAGGTGGGCCAGGTGGATGTGGG - Intergenic
1103266094 12:119631542-119631564 CAGGATGGCAAATTTGATGTTGG + Intronic
1103293904 12:119869958-119869980 CAAGTGGGCCAGTTGGAAGATGG - Intronic
1105598219 13:21860338-21860360 CAAGTTGGAAACTTGGAACTTGG - Intergenic
1108447960 13:50528062-50528084 CAGGTTGGCACTTTGCATGTGGG + Intronic
1109489671 13:63080372-63080394 CAAGCTGGCAAGTAGGTTGTGGG + Intergenic
1109788205 13:67210523-67210545 GAAGTAGGCCAGATGGATGTTGG + Intronic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112734721 13:102402770-102402792 CATGTTGGGAGGTTGGAGGTGGG + Intergenic
1112742778 13:102494057-102494079 CAAGTCCACAAGTTGGATCTTGG + Intergenic
1117737715 14:58784563-58784585 CAAGTTCTCAAGTAAGATGTTGG - Intergenic
1124784799 15:32669578-32669600 CAACTTGGCAATTTGTATGAAGG - Intronic
1125978226 15:43974940-43974962 CAATTTGCCAAGTTGCCTGTTGG + Intronic
1129878431 15:78992114-78992136 CAAGTTGCTAAGCTGGAAGTGGG + Intronic
1134894171 16:17869824-17869846 CAAGGTAGCATGTTGGAAGTTGG + Intergenic
1135430397 16:22377624-22377646 AAAGATAGCAAGTTGGATTTAGG + Intronic
1135741218 16:24976708-24976730 CATGATGGCAAGTTGGCTATTGG - Intronic
1136775778 16:32871014-32871036 GACGGAGGCAAGTTGGATGTCGG + Intergenic
1136894839 16:33990498-33990520 GACGGAGGCAAGTTGGATGTCGG - Intergenic
1203078194 16_KI270728v1_random:1133123-1133145 GACGGAGGCAAGTTGGATGTCGG + Intergenic
1144280704 17:13723568-13723590 CAAAATGAAAAGTTGGATGTAGG + Intergenic
1146183504 17:30710939-30710961 CATGTTGGGATGTGGGATGTGGG - Intergenic
1147611075 17:41802142-41802164 CAGGTTGGCAAGTGGGCTGATGG - Exonic
1148935439 17:51161262-51161284 CAAGTTGGCAGGTGAGATTTTGG + Exonic
1150589439 17:66549250-66549272 CAAGTTTGTAAATTGGGTGTGGG + Intronic
1151859296 17:76747795-76747817 CAAGTTGGGGAGGTGGATGAGGG + Intronic
1159575593 18:70172313-70172335 CAAGTAGGTAGTTTGGATGTTGG - Intronic
1159624121 18:70671837-70671859 GAAGTAACCAAGTTGGATGTTGG + Intergenic
1162975286 19:14204822-14204844 CATGTTGGGAAGTGGGATGTGGG + Intronic
1164577344 19:29413270-29413292 CGGGTTGGCAAGGTGGCTGTGGG - Intergenic
1164642038 19:29833130-29833152 CAAGTTGGGAAGTTGGGAGAGGG - Intergenic
1166796235 19:45428012-45428034 CAAGTTGGCAAGTTGGATGTTGG + Intronic
1167392080 19:49202102-49202124 CAAGTTGACCAGCAGGATGTTGG - Exonic
927440860 2:23116405-23116427 AAAGTAGGCAAGGTGGAGGTAGG + Intergenic
929578976 2:43069910-43069932 CAAGTTGTAAAGTCTGATGTGGG + Intergenic
930855953 2:56018286-56018308 CAAGAGGGCAACTTGGAAGTGGG + Intergenic
931245172 2:60486316-60486338 AAAGTTGCCAAATTGGAGGTGGG - Intronic
932086802 2:68769774-68769796 CAAGAGGTCAAATTGGATGTAGG + Intronic
932440345 2:71730938-71730960 CAAGGTGGAATGTGGGATGTGGG - Intergenic
932634998 2:73380354-73380376 CCTGTGGGCAAGTTAGATGTGGG + Intergenic
933695823 2:85216383-85216405 CCAGATGGCAAGTGGGCTGTCGG - Intronic
935429728 2:102962453-102962475 AATGTTGGCAATTTGGAAGTAGG + Intergenic
943042132 2:182816037-182816059 CAAGTTGTGAAATTGGATGCTGG + Intergenic
943650804 2:190455881-190455903 CAAGTTGACAGGTTTGAGGTAGG + Intronic
944597381 2:201273386-201273408 CAAGCTGGCAAGTTTGAAATAGG + Intronic
945447441 2:209955004-209955026 CAAGTGGGGAAGGTGGATGCAGG + Intronic
946000976 2:216481899-216481921 AAAGTTGGAAATTTAGATGTAGG + Intronic
947199796 2:227604905-227604927 CTAGTTTGAAAGTTGGCTGTGGG + Intergenic
947442383 2:230134437-230134459 TAAGTTGGAAATTTGGATTTAGG + Intergenic
948691842 2:239711238-239711260 GAAGTTTGCAAGTTGGGTTTGGG - Intergenic
1169019164 20:2315820-2315842 CAAGTTGGCAAGTGGCAAGGTGG + Intronic
1172886621 20:38235509-38235531 CAAGGTGCCAAGATGGATGGGGG + Intronic
1173715483 20:45199891-45199913 CAAGTGGGTGAGTGGGATGTGGG + Intergenic
1180020304 21:45120257-45120279 CAAGTTTGCATGTCAGATGTTGG + Intronic
1183660271 22:39216024-39216046 GAAGTTGGCACCTTGGATGCAGG - Intergenic
1184566070 22:45292990-45293012 AAAGTTGGAAAGTGGAATGTGGG + Intronic
951699573 3:25481700-25481722 AAAGAAGGTAAGTTGGATGTAGG - Intronic
953042344 3:39266643-39266665 CAAGATGGCAAGTGGGAAGTTGG - Intronic
954872364 3:53777418-53777440 CATGTTAGGAAGTTGGCTGTTGG + Intronic
954965131 3:54603584-54603606 TAAGCTGGCAAGTTGGATGATGG + Intronic
959420977 3:106128009-106128031 CAAGTTGGCAAGTTAAAAGAAGG - Intergenic
960239816 3:115327334-115327356 CACTTTGGAAATTTGGATGTAGG + Intergenic
960736676 3:120788791-120788813 CTTGCTGGTAAGTTGGATGTGGG - Intergenic
963654285 3:148025390-148025412 CCAGTTGGAAAGTTTGATGCAGG + Intergenic
964664203 3:159154129-159154151 CAAATTGTCAAGTTTTATGTGGG + Intronic
968854684 4:3110894-3110916 GAAATTGGTTAGTTGGATGTTGG + Intronic
970568307 4:17353936-17353958 GAAGATGGGAAGTAGGATGTTGG - Intergenic
975114970 4:70670301-70670323 CATGCTGGTAAATTGGATGTAGG - Intronic
980166373 4:129232908-129232930 CAAGTTGGCAAGCTGAAATTTGG + Intergenic
981917483 4:150050836-150050858 TAAGGTGGCAATTTGGAAGTTGG - Intergenic
982345038 4:154348080-154348102 CAAGTTGGCAACAGGGATGTGGG + Intronic
983030194 4:162791212-162791234 CAAGTGGGGAGGTTGGCTGTTGG + Intergenic
984873836 4:184350094-184350116 CAAGATGGCCACTTGGATGGAGG + Intergenic
986177967 5:5367898-5367920 GAAGAGAGCAAGTTGGATGTAGG - Intergenic
987010340 5:13756308-13756330 CAAGTTCAGAAGTTGGTTGTAGG + Intronic
989949662 5:50282274-50282296 CAGGCTGGCAAATTGGATATGGG + Intergenic
992964548 5:81986354-81986376 CAAGTTGGTTAGATGGAGGTTGG + Intronic
994464104 5:100105562-100105584 CATATTGGCTGGTTGGATGTGGG - Intergenic
1000438110 5:161238478-161238500 AAGGGTGGCAAGTTGGATGGGGG + Intergenic
1004583434 6:16976708-16976730 CAGGTTGGCAGGTTGAATGGTGG - Intergenic
1005802142 6:29437453-29437475 CAAGTGGGAAAGTTGAATATGGG - Intronic
1008379854 6:50828832-50828854 CATGTTGGGAAGATGGAAGTTGG + Intronic
1008444148 6:51569072-51569094 CATGTTGGCAAGCTAGCTGTGGG - Intergenic
1010213358 6:73380596-73380618 AAAGTAAGCAAGTTTGATGTGGG + Intronic
1010367905 6:75073608-75073630 CAAGTTGGCAGGGTGGGTGAAGG - Intergenic
1018429485 6:163712353-163712375 CAAGCTGCCAAGGAGGATGTGGG - Intergenic
1023163356 7:37319632-37319654 AAAGTAGGCAAGTTGAGTGTAGG - Intronic
1028951887 7:96645479-96645501 CAGGTAGACAAGTTGGGTGTTGG + Intronic
1029889227 7:103908675-103908697 CAAGTTAGCTATTTGGAAGTTGG + Intronic
1030982131 7:116198736-116198758 CAAGTTTGCAAGCTGGAAGCTGG + Intergenic
1034831184 7:154309158-154309180 CAAGTTAGCCAGTGGAATGTAGG - Intronic
1036013457 8:4754320-4754342 CAAGGTTTCAAGTTGAATGTTGG - Intronic
1038519017 8:28213397-28213419 CAAGTAGATAAGTTGGGTGTGGG + Intergenic
1041084224 8:54242359-54242381 CATGTTGGCCAGGTTGATGTTGG + Intergenic
1041569565 8:59322291-59322313 GAAGATGGCAAGTTGGATTCAGG - Intergenic
1044572228 8:93733715-93733737 GAAGGTGGCAAGTTTGATTTTGG - Exonic
1045959784 8:107953565-107953587 AAAGTTGGGAAGTTTAATGTTGG + Intronic
1048101812 8:131360246-131360268 CAGAGTGGCAAGTTGGATGAAGG - Intergenic
1055231491 9:74072263-74072285 CAGAGTGGCAAGTTGGATGACGG - Intergenic
1057758934 9:97857579-97857601 CAAGTTGACAAGTAGAATGGGGG - Intergenic
1061463012 9:130755266-130755288 CCAGTAGGCATCTTGGATGTGGG + Intronic
1186511773 X:10135048-10135070 CAGGTTGGGAAGTTACATGTGGG - Intronic
1187123361 X:16430503-16430525 TAAGTTGGCAAATTGCAAGTGGG - Intergenic
1188100470 X:26076395-26076417 CCAGTTTGTAAGTTGGATGGTGG - Intergenic
1198978908 X:142371009-142371031 CTTGTTGGCCAGTTGGATATGGG - Intergenic
1200104117 X:153703024-153703046 GACGGAGGCAAGTTGGATGTCGG - Exonic
1200373292 X:155750879-155750901 AAAGGTGGAAAGTTGGATTTAGG + Intergenic
1200426112 Y:3022179-3022201 TAAGGTGGGAAGTGGGATGTGGG + Intergenic