ID: 1166802729

View in Genome Browser
Species Human (GRCh38)
Location 19:45468320-45468342
Sequence ACGGAGCCTGCACTTTCAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166802721_1166802729 -2 Left 1166802721 19:45468299-45468321 CCTCCCTCGCCCCTGGGTCCTAC 0: 1
1: 0
2: 0
3: 18
4: 259
Right 1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1166802723_1166802729 -5 Left 1166802723 19:45468302-45468324 CCCTCGCCCCTGGGTCCTACGGA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1166802720_1166802729 -1 Left 1166802720 19:45468298-45468320 CCCTCCCTCGCCCCTGGGTCCTA 0: 1
1: 0
2: 0
3: 19
4: 285
Right 1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1166802715_1166802729 14 Left 1166802715 19:45468283-45468305 CCCTGGGGGAGCAACCCCTCCCT 0: 1
1: 0
2: 1
3: 31
4: 188
Right 1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1166802724_1166802729 -6 Left 1166802724 19:45468303-45468325 CCTCGCCCCTGGGTCCTACGGAG 0: 1
1: 0
2: 2
3: 9
4: 117
Right 1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1166802719_1166802729 0 Left 1166802719 19:45468297-45468319 CCCCTCCCTCGCCCCTGGGTCCT 0: 1
1: 0
2: 1
3: 71
4: 551
Right 1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1166802716_1166802729 13 Left 1166802716 19:45468284-45468306 CCTGGGGGAGCAACCCCTCCCTC 0: 1
1: 0
2: 2
3: 21
4: 261
Right 1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1166802714_1166802729 15 Left 1166802714 19:45468282-45468304 CCCCTGGGGGAGCAACCCCTCCC 0: 1
1: 0
2: 1
3: 22
4: 210
Right 1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166802729 Original CRISPR ACGGAGCCTGCACTTTCAAG AGG Exonic
900292379 1:1928993-1929015 ACGCAGCCTGAAATCTCAAGGGG - Intronic
903565922 1:24265906-24265928 AAGGAGCCTGCACTCTCACGTGG - Intergenic
903582514 1:24382432-24382454 AGGGAGTCTCCACTTTCATGAGG + Intronic
903617159 1:24668694-24668716 AGGAAGTCTGCACTTTAAAGAGG - Intronic
911231112 1:95362694-95362716 AGGGAGTCTGCATTTTAAAGAGG - Intergenic
912410260 1:109476398-109476420 TCTGGGCCTGCACTTTCCAGAGG + Intronic
916975664 1:170074732-170074754 ACTGAGCCTGCGCATACAAGAGG - Intronic
1065997319 10:31071013-31071035 AGGGAGCCAGAACTTTAAAGAGG - Intergenic
1077543195 11:3157324-3157346 AAGGAGCCTGGACTTACGAGAGG + Intronic
1079455388 11:20631952-20631974 AAAGAGCCAGCACTTTCCAGGGG + Intronic
1081505030 11:43707217-43707239 ATGGAGCCTGCATTTTAATGAGG + Intronic
1083208870 11:61170238-61170260 CCTGAGCTTGCACTTTCACGGGG - Intergenic
1085857741 11:80195072-80195094 ATGGAACCAGCACTTTCAAATGG - Intergenic
1091141430 11:133238602-133238624 AAGAAGCCTGCACTTGCAGGTGG - Intronic
1101477568 12:105065055-105065077 AAGGAGCCTGCAGTTTTATGGGG - Intronic
1106086068 13:26542936-26542958 AAGGAGCCTGCAGTTTTAATGGG + Intergenic
1106304557 13:28498043-28498065 AAGGAGCCTGAACTGTCCAGAGG - Intergenic
1106900813 13:34353269-34353291 ACGGAGCCTGCCCGTGCAAAAGG + Intergenic
1109863414 13:68229425-68229447 AAAGAACCTGCACTTACAAGAGG + Intergenic
1110025815 13:70538055-70538077 GCGTAGACTGCACTTTCAGGAGG - Intergenic
1114776272 14:25485640-25485662 TCTGAGCCTGCACTTTTAAGAGG - Intergenic
1118980216 14:70710133-70710155 TGGGAGCCAGCCCTTTCAAGAGG - Intergenic
1120433715 14:84452908-84452930 ATATAGGCTGCACTTTCAAGTGG + Intergenic
1121919743 14:97869538-97869560 AAGGAGCCTGTCTTTTCAAGAGG + Intergenic
1131514787 15:93070070-93070092 AGGGCCCCTGCACTGTCAAGCGG - Intronic
1132141814 15:99403246-99403268 ACAGCGCCTGCCCTTTGAAGGGG - Intergenic
1132559226 16:585603-585625 ACGGAGCCTGCAGGTGCAGGCGG - Intergenic
1134069063 16:11249621-11249643 ACGGCGCCTGCACTCTCGAGAGG - Intronic
1135721897 16:24824490-24824512 ACGGGCCCTGCACTTTGAATAGG + Exonic
1138142225 16:54578601-54578623 CCAGAGCCTGAACTTTCAACAGG - Intergenic
1140258408 16:73356673-73356695 ACGGAGCCAGCATTTCCATGGGG + Intergenic
1149567690 17:57651629-57651651 AAGGTGCCTGCTCTGTCAAGAGG + Intronic
1151823272 17:76508835-76508857 ACAGAGCCTCCACTTTCGAGGGG + Intergenic
1151825115 17:76519666-76519688 ACAGAGTCTCCACTTTCGAGGGG - Intergenic
1153089131 18:1323946-1323968 ACTGAGCATGCAGCTTCAAGAGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157892727 18:51433405-51433427 ACTGAGCCTTCACTTTGAAAAGG + Intergenic
1157944164 18:51959848-51959870 AAGGAGCCTGCAATTTCCACTGG - Intergenic
1161344710 19:3762603-3762625 ACGGGGCCTACACTTCCACGGGG + Intergenic
1164427283 19:28152908-28152930 ACGTAGCCTGCACTTTCTCAGGG - Intergenic
1166802729 19:45468320-45468342 ACGGAGCCTGCACTTTCAAGAGG + Exonic
925346502 2:3175589-3175611 ATGGAACCTGCACCTTCAGGAGG + Intergenic
930835200 2:55785496-55785518 ACTGAGCCATCACTTACAAGGGG - Intergenic
934966638 2:98730419-98730441 ACGGGGGCTGCTCTTTCACGCGG + Intronic
935846734 2:107174025-107174047 ACAGAGCCTGCACTTTCCTTAGG + Intergenic
936032913 2:109086603-109086625 ACAGAGCCTGCACTTTACAAAGG - Intergenic
937425253 2:121793676-121793698 ACAGAGCCTGCCCAGTCAAGAGG - Intergenic
940977990 2:159968339-159968361 ACTGAGCCTGCCCTTGCAATTGG - Intronic
941440057 2:165523515-165523537 ACAGAGCATGCACTTTCTAAAGG + Intronic
944391171 2:199221323-199221345 ACGGAGGCTTCATCTTCAAGGGG - Intergenic
947522779 2:230861470-230861492 ATGGAGACTGAATTTTCAAGAGG + Intergenic
947955443 2:234186356-234186378 ATGGAGCCTGCCCTTACAATAGG - Intergenic
1177009735 21:15717338-15717360 AAGGTGCCTGCACTTTGTAGAGG - Intergenic
1179480089 21:41671503-41671525 AGGGAGCCTGCACCTGCAGGTGG + Intergenic
1180552120 22:16549051-16549073 ACAGACCCTTGACTTTCAAGTGG + Intergenic
949138274 3:599217-599239 ACGGAGCTTGCATTTTAATGAGG + Intergenic
950644130 3:14367156-14367178 AGGGAGCCTGCACTCACACGAGG + Intergenic
951188717 3:19744392-19744414 GCTGAACCTGAACTTTCAAGGGG + Intergenic
951206581 3:19932156-19932178 AAGGAGACTGCACTTTTGAGAGG - Intronic
956044068 3:65176469-65176491 ATGGAGGCAGCACATTCAAGGGG - Intergenic
956496929 3:69837428-69837450 ACTGAGCCTGTACTCTCAAGAGG + Intronic
958845334 3:99259021-99259043 ACTTATCCTGCTCTTTCAAGTGG + Intergenic
977080679 4:92523805-92523827 ACAGGGCCTACACTTCCAAGAGG + Intronic
979066417 4:116141281-116141303 AGGGAACCTGGACTTGCAAGAGG + Intergenic
981913644 4:150010482-150010504 ACGGTGCTTGCATTTTTAAGTGG - Intergenic
982227487 4:153179695-153179717 ATGGAAGCTGCACTCTCAAGGGG + Intronic
982368345 4:154605519-154605541 ACAGAGGCTGCACTTTAAAATGG - Intronic
992947768 5:81826192-81826214 ATGGAGCCTGAGCTTTTAAGAGG + Intergenic
998887846 5:146713109-146713131 AGGGAGGCTGCAATTTCAATAGG + Intronic
1000170058 5:158693760-158693782 ACAGAGCATGCACTTGCCAGTGG + Intergenic
1000483894 5:161814734-161814756 ACACAGCCTGGATTTTCAAGTGG - Intergenic
1001251154 5:170147808-170147830 AAGGAGCCTGCATTTTAAATAGG - Intergenic
1012735061 6:102928424-102928446 TCTGAGACTGCACCTTCAAGAGG + Intergenic
1015371422 6:132458186-132458208 AAGGACACTGCACTTTGAAGAGG - Exonic
1017906256 6:158759167-158759189 ACTGAGCCTGCTCTGGCAAGTGG + Intronic
1019365909 7:632711-632733 ACGGAGGCTGCACTCTCTACCGG + Intronic
1022179158 7:27901596-27901618 TCTGAGACTGCAGTTTCAAGTGG - Intronic
1023036334 7:36134506-36134528 ACAGAGTCTGATCTTTCAAGTGG + Intergenic
1024809826 7:53195741-53195763 CCGGAGCCTGCACCTTCCAGTGG - Intergenic
1032551941 7:132792264-132792286 AGGGAGCCTGCATTTTCTAATGG + Intronic
1039399909 8:37260886-37260908 TGGGAGCCTGCACTCTCAATCGG - Intergenic
1039553940 8:38463482-38463504 AAGGAGCCTGCAGTTTCGTGGGG - Intronic
1043728027 8:83636686-83636708 ACAGAGTCTGCATATTCAAGAGG - Intergenic
1044485434 8:92747602-92747624 ACTGAGGGTCCACTTTCAAGAGG - Intergenic
1052287735 9:26805917-26805939 ACGGACCCTGCTCTTTCCCGGGG + Intergenic
1052819778 9:33129449-33129471 ACGGAGGCTTCACTTCCAAGAGG + Intronic
1062381625 9:136289706-136289728 ACGGAACGTGCACTTTAACGTGG + Intronic
1187932725 X:24308430-24308452 ATGGTGCCTGCACTTTTAAGAGG - Intergenic
1189001986 X:36957646-36957668 ACGGAGCCAGCCCTGTCGAGCGG + Intergenic
1190223362 X:48527449-48527471 TCTGAGCCTGCACTCTCAGGTGG + Intronic
1197288663 X:124627479-124627501 ACGGAGCCTGGCCTTTTTAGGGG - Intronic