ID: 1166802814

View in Genome Browser
Species Human (GRCh38)
Location 19:45468693-45468715
Sequence TACCTGGGAGGCGGCGGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6783
Summary {0: 1, 1: 0, 2: 20, 3: 399, 4: 6363}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166802814_1166802824 9 Left 1166802814 19:45468693-45468715 CCACCGCCGCCGCCTCCCAGGTA 0: 1
1: 0
2: 20
3: 399
4: 6363
Right 1166802824 19:45468725-45468747 TAGTAGGGGTGCTGCTTTGTAGG 0: 1
1: 0
2: 0
3: 12
4: 153
1166802814_1166802821 -7 Left 1166802814 19:45468693-45468715 CCACCGCCGCCGCCTCCCAGGTA 0: 1
1: 0
2: 20
3: 399
4: 6363
Right 1166802821 19:45468709-45468731 CCAGGTAAGTTTTTGATAGTAGG 0: 1
1: 0
2: 0
3: 13
4: 139
1166802814_1166802825 29 Left 1166802814 19:45468693-45468715 CCACCGCCGCCGCCTCCCAGGTA 0: 1
1: 0
2: 20
3: 399
4: 6363
Right 1166802825 19:45468745-45468767 AGGTTTTATTTTTTAAGTCAAGG 0: 1
1: 0
2: 14
3: 133
4: 1679
1166802814_1166802822 -6 Left 1166802814 19:45468693-45468715 CCACCGCCGCCGCCTCCCAGGTA 0: 1
1: 0
2: 20
3: 399
4: 6363
Right 1166802822 19:45468710-45468732 CAGGTAAGTTTTTGATAGTAGGG 0: 1
1: 0
2: 0
3: 16
4: 165
1166802814_1166802823 -5 Left 1166802814 19:45468693-45468715 CCACCGCCGCCGCCTCCCAGGTA 0: 1
1: 0
2: 20
3: 399
4: 6363
Right 1166802823 19:45468711-45468733 AGGTAAGTTTTTGATAGTAGGGG 0: 1
1: 0
2: 1
3: 11
4: 174
1166802814_1166802826 30 Left 1166802814 19:45468693-45468715 CCACCGCCGCCGCCTCCCAGGTA 0: 1
1: 0
2: 20
3: 399
4: 6363
Right 1166802826 19:45468746-45468768 GGTTTTATTTTTTAAGTCAAGGG 0: 1
1: 0
2: 6
3: 86
4: 854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166802814 Original CRISPR TACCTGGGAGGCGGCGGCGG TGG (reversed) Exonic
Too many off-targets to display for this crispr