ID: 1166803423

View in Genome Browser
Species Human (GRCh38)
Location 19:45471403-45471425
Sequence GACGTTCCACACATGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 48}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166803414_1166803423 14 Left 1166803414 19:45471366-45471388 CCTCTCCACCTGTACCCTTATCC 0: 1
1: 0
2: 1
3: 16
4: 235
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803408_1166803423 29 Left 1166803408 19:45471351-45471373 CCCCATTCTCTGCCCCCTCTCCA 0: 1
1: 0
2: 6
3: 108
4: 1176
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803418_1166803423 6 Left 1166803418 19:45471374-45471396 CCTGTACCCTTATCCTGGGTTGA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803411_1166803423 17 Left 1166803411 19:45471363-45471385 CCCCCTCTCCACCTGTACCCTTA 0: 1
1: 0
2: 3
3: 25
4: 340
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803409_1166803423 28 Left 1166803409 19:45471352-45471374 CCCATTCTCTGCCCCCTCTCCAC 0: 1
1: 0
2: 7
3: 83
4: 916
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803420_1166803423 -1 Left 1166803420 19:45471381-45471403 CCTTATCCTGGGTTGAGAACTAG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803413_1166803423 15 Left 1166803413 19:45471365-45471387 CCCTCTCCACCTGTACCCTTATC 0: 1
1: 0
2: 0
3: 24
4: 276
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803412_1166803423 16 Left 1166803412 19:45471364-45471386 CCCCTCTCCACCTGTACCCTTAT 0: 1
1: 0
2: 1
3: 29
4: 279
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803421_1166803423 -7 Left 1166803421 19:45471387-45471409 CCTGGGTTGAGAACTAGACGTTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803419_1166803423 0 Left 1166803419 19:45471380-45471402 CCCTTATCCTGGGTTGAGAACTA 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803410_1166803423 27 Left 1166803410 19:45471353-45471375 CCATTCTCTGCCCCCTCTCCACC 0: 1
1: 2
2: 11
3: 192
4: 1457
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48
1166803417_1166803423 9 Left 1166803417 19:45471371-45471393 CCACCTGTACCCTTATCCTGGGT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166803423 Original CRISPR GACGTTCCACACATGGAACT AGG Intronic
900683153 1:3928982-3929004 GACCTTCCACACATAGATTTGGG - Intergenic
900949500 1:5850364-5850386 GACGTTAAACACATGTCACTGGG + Intergenic
911418893 1:97614050-97614072 GTAGTTCCACACATGGTATTGGG + Intronic
923117660 1:230958528-230958550 GAGCTTCCACACCTGGAACCTGG + Intronic
1068163867 10:53303080-53303102 CACTTTCCTCCCATGGAACTGGG - Intergenic
1069191197 10:65493228-65493250 GAAGTTCAAAACATGGAATTTGG + Intergenic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1079421634 11:20296404-20296426 GAAGTTCCACAAATAGAGCTGGG - Intergenic
1097160213 12:57040958-57040980 GACTTTCCACACATGTACCCTGG + Intronic
1100618301 12:96248597-96248619 CATTTTCCACACATGGAACCTGG - Intronic
1106488619 13:30195015-30195037 GAGGATTCACACATGGAAATTGG - Intergenic
1110322020 13:74171358-74171380 GACGTTCCACACATCCAGTTAGG + Intergenic
1120642297 14:87029794-87029816 CACCTTCCTCACATGGCACTAGG - Intergenic
1133361381 16:5176659-5176681 AAGGTTCCACATATGGATCTCGG - Intergenic
1135382245 16:22004885-22004907 GACGCACCACACATGTACCTGGG - Intergenic
1137385012 16:48033429-48033451 GAGGAGGCACACATGGAACTGGG - Intergenic
1140892216 16:79294887-79294909 GGCATTCCAGACATGGAACAAGG + Intergenic
1142969896 17:3604202-3604224 GACATTCCAAACATGGGCCTTGG + Intergenic
1143532290 17:7512503-7512525 GAGATTCCACCCATGGGACTGGG - Exonic
1159310406 18:66700192-66700214 GACTTTCCACAAATGTAAATAGG - Intergenic
1160332637 18:78009358-78009380 GACTTCCCACACATGGAGCCAGG + Intergenic
1164283810 19:23792294-23792316 GAGGTTCCCCAAAAGGAACTGGG - Intronic
1166803423 19:45471403-45471425 GACGTTCCACACATGGAACTAGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
929443755 2:41986917-41986939 GACATTCTACACATGGGAGTTGG - Intergenic
931773755 2:65522214-65522236 GACATTCAACAAATGGAGCTGGG - Intergenic
946444767 2:219728752-219728774 GAAGCTCCACATCTGGAACTGGG + Intergenic
1170164678 20:13348723-13348745 GGACTTCCAGACATGGAACTGGG + Intergenic
952988508 3:38810058-38810080 GAAGTTCCCCACTGGGAACTTGG + Intergenic
954795685 3:53160543-53160565 TCCTTTCCAGACATGGAACTTGG - Intronic
963774133 3:149421318-149421340 GCCGTTACACACTTGGAAGTCGG + Intergenic
983305263 4:165976761-165976783 GAGGTTCTTTACATGGAACTGGG + Intronic
984212411 4:176866858-176866880 GAGGTTCCACAGATGCTACTGGG - Intergenic
984336848 4:178403234-178403256 GACGTGCAATAAATGGAACTTGG + Intergenic
990439696 5:55832332-55832354 GAGGTGCCACACAAGCAACTAGG - Intergenic
992495575 5:77290128-77290150 CATTTTCCACACGTGGAACTAGG - Intronic
999717437 5:154372721-154372743 GAGGTCCGACACATGGACCTCGG + Intronic
1001204724 5:169751805-169751827 CATGTTCCAGACATGGAACTGGG + Intronic
1002298510 5:178244695-178244717 GAGGTTCAACACATGGATCCAGG - Intronic
1019908171 7:4080488-4080510 GACGATCCACTCCTGGAAATTGG + Intronic
1035878268 8:3215409-3215431 TATGTACCAGACATGGAACTAGG + Intronic
1037959855 8:23088477-23088499 CACGCACCACACATGGAACCAGG + Intronic
1039044373 8:33436446-33436468 GATGTTGCCCACATGCAACTTGG + Intronic
1044996759 8:97844692-97844714 GACTTTCAACACAAGGAAGTAGG - Intronic
1046112406 8:109741118-109741140 GATGTACCCCAAATGGAACTGGG - Intergenic
1046311897 8:112448341-112448363 GAGCTTCCACATATGAAACTGGG + Intronic
1050056588 9:1661605-1661627 GACCTTCCAGACTTGGAAGTTGG - Intergenic
1055806434 9:80099492-80099514 GATGTTCTACACATGAAGCTAGG - Intergenic
1060966013 9:127712744-127712766 GACGTTCCAGCCATGGCACAAGG + Exonic
1192181102 X:68916316-68916338 GATGTTCCAGGCATTGAACTGGG + Intergenic