ID: 1166804037

View in Genome Browser
Species Human (GRCh38)
Location 19:45474192-45474214
Sequence CCTCACATCCTCTCCAGGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 340}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166804028_1166804037 -10 Left 1166804028 19:45474179-45474201 CCACCCCTTGGCCCCTCACATCC 0: 1
1: 0
2: 5
3: 59
4: 628
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804015_1166804037 27 Left 1166804015 19:45474142-45474164 CCCCCGACCAATCCCCAGCCTAG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804018_1166804037 25 Left 1166804018 19:45474144-45474166 CCCGACCAATCCCCAGCCTAGGA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804022_1166804037 14 Left 1166804022 19:45474155-45474177 CCCAGCCTAGGACGCCAACTTCT 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804026_1166804037 0 Left 1166804026 19:45474169-45474191 CCAACTTCTCCCACCCCTTGGCC 0: 1
1: 1
2: 2
3: 43
4: 622
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804021_1166804037 15 Left 1166804021 19:45474154-45474176 CCCCAGCCTAGGACGCCAACTTC 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804024_1166804037 9 Left 1166804024 19:45474160-45474182 CCTAGGACGCCAACTTCTCCCAC 0: 1
1: 0
2: 0
3: 17
4: 258
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804019_1166804037 24 Left 1166804019 19:45474145-45474167 CCGACCAATCCCCAGCCTAGGAC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804020_1166804037 20 Left 1166804020 19:45474149-45474171 CCAATCCCCAGCCTAGGACGCCA 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804023_1166804037 13 Left 1166804023 19:45474156-45474178 CCAGCCTAGGACGCCAACTTCTC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804027_1166804037 -9 Left 1166804027 19:45474178-45474200 CCCACCCCTTGGCCCCTCACATC 0: 1
1: 0
2: 2
3: 42
4: 332
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340
1166804016_1166804037 26 Left 1166804016 19:45474143-45474165 CCCCGACCAATCCCCAGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG 0: 1
1: 0
2: 0
3: 48
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166804037 Original CRISPR CCTCACATCCTCTCCAGGAA GGG Exonic
900361795 1:2292731-2292753 CCTCACGTCCTCCCCAGCAGGGG - Intronic
901036284 1:6338219-6338241 CCATCCCTCCTCTCCAGGAAGGG + Intronic
902044854 1:13516572-13516594 ACTCACCCCCTCTCCAGGAAGGG + Intergenic
902598550 1:17525460-17525482 CCTCAGTTTCTCTCTAGGAAAGG + Intergenic
902987799 1:20166026-20166048 CCTCACCACCACCCCAGGAATGG - Intronic
903277651 1:22232044-22232066 GCTCACATCCTGTGGAGGAAGGG + Intergenic
903930067 1:26856884-26856906 GCTCTCTGCCTCTCCAGGAATGG + Exonic
904355372 1:29935273-29935295 GCTCACATTCTCTTCTGGAAAGG - Intergenic
904995877 1:34630953-34630975 CCTCACATCCTATCCCCAAATGG + Intergenic
905544399 1:38786267-38786289 ACTGACATCATTTCCAGGAAAGG + Intergenic
906701628 1:47863603-47863625 CACCACATCCTCTCCAGCACTGG - Intronic
907983271 1:59505698-59505720 ACTGTTATCCTCTCCAGGAAGGG - Intronic
908903968 1:68986479-68986501 TCTCAACTCCTCTCCAGCAAGGG + Intergenic
910452931 1:87365232-87365254 CTCCACATCCTCTCCAGCATCGG + Intergenic
912452784 1:109777451-109777473 TCCCTCATCCTCTCCAGGGAAGG - Intergenic
915052051 1:153085138-153085160 CCACACAGCCTCTCTAGCAAGGG + Intergenic
915147341 1:153802858-153802880 CCTCAGCTCCTCTCCGGGGAGGG + Intergenic
915287213 1:154860682-154860704 CCACACGTGCTCTCCAGGCAGGG + Intronic
915846354 1:159269663-159269685 TCGCAAATCCTCTCCAGGAAGGG + Intergenic
917536402 1:175877550-175877572 CCCCACGTCCACACCAGGAAAGG + Intergenic
917915354 1:179695447-179695469 TCTCAACTCCTCTCCAGCAAGGG + Intergenic
918592642 1:186257235-186257257 CTCCACATCCTCTCCAGCACTGG + Intergenic
919044203 1:192430705-192430727 ACTTACACCCTCTGCAGGAATGG - Intergenic
919871329 1:201823932-201823954 CCTCACATCCTCACTTGGGATGG + Exonic
920406768 1:205720491-205720513 CTTCACATACTCTCCTGGAATGG + Exonic
923803043 1:237229124-237229146 CATCGCATCTTCTCCAGGAAAGG + Intronic
1063528265 10:6804786-6804808 CTCCACATCCTCTCCAGCACCGG + Intergenic
1063538293 10:6906991-6907013 CTCCACATCCTCTCCAGCACCGG - Intergenic
1065046312 10:21750236-21750258 CCTCACAGCCTTGTCAGGAATGG - Intergenic
1065189596 10:23197380-23197402 CTTCACACCCTCTCCACGGAGGG - Intergenic
1065671213 10:28120193-28120215 CCTCAAAGCATTTCCAGGAAAGG - Exonic
1067933826 10:50591011-50591033 CCTCAAATCCTTTCCAGCAAAGG + Intronic
1070292053 10:75123560-75123582 ACTCCCACCCTCACCAGGAAAGG - Intronic
1072240395 10:93490300-93490322 CTTCACATCATCTCCAAGCAAGG - Intergenic
1072535304 10:96358016-96358038 ACTCACAACCTCCCCATGAAGGG + Intronic
1076222388 10:128745061-128745083 GTTCTCATCCTATCCAGGAATGG + Intergenic
1076565175 10:131393655-131393677 CCCCACATCCACTCCAGCATGGG + Intergenic
1076627010 10:131827573-131827595 CTCCACATCCTCTCCAGCATCGG + Intergenic
1076677252 10:132153528-132153550 CCTGACACCTTCTCCAGGAGAGG - Intronic
1077450621 11:2641294-2641316 CTCCACATCCTCTCCAGCATTGG + Intronic
1077499144 11:2901462-2901484 CCCCACCTCCTCCCCAGGCAAGG - Intronic
1077610691 11:3641859-3641881 CCTCACGTCTCCTCCAGGGATGG - Exonic
1078542545 11:12223480-12223502 TCTGTCAACCTCTCCAGGAAGGG + Exonic
1079809589 11:24980709-24980731 CCTATCACCCTTTCCAGGAATGG - Intronic
1080796162 11:35565586-35565608 CCTCCCATCATCTTCAGGGAAGG - Intergenic
1081342578 11:41946487-41946509 ACTCACACACTCTTCAGGAATGG + Intergenic
1081612871 11:44573617-44573639 CCCCACACCCTCTCCTGGCATGG + Intronic
1082273211 11:50194382-50194404 CTCCACATCCTCTCCAGCACCGG + Intergenic
1083731874 11:64656678-64656700 CCTCTCCTCCCCTCCAGGGAGGG + Intronic
1085509861 11:77082721-77082743 CCTTCCATCCTCCCCAGGAGTGG + Intronic
1086310234 11:85527836-85527858 CTCCACATCCTCACCAGCAACGG + Intronic
1086328747 11:85732094-85732116 CTCCACATCCTCTCCAGCATCGG - Intronic
1087068939 11:94055642-94055664 CCTCACATCTTCACCAGCATTGG - Intronic
1088768691 11:113011602-113011624 CTCCACATCCTCTCCAGCATTGG + Intronic
1089354633 11:117841683-117841705 CCTCCTTTCCTCTCCAGGAGAGG + Intronic
1089670820 11:120055908-120055930 CCTCACTCCCACCCCAGGAAGGG + Intergenic
1089969659 11:122682641-122682663 CCTCTCATTCTCTCCTGGCAGGG + Intronic
1090443638 11:126745096-126745118 CATGAGATCCTCTCAAGGAAAGG - Intronic
1090733283 11:129590166-129590188 CTTCACCTCCTCTCCACAAAGGG + Intergenic
1091357962 11:134952479-134952501 CTTCACATCCTCACCAGCACAGG + Intergenic
1091654084 12:2332414-2332436 ACTCACATCCTCTCCTTCAATGG - Intronic
1092441309 12:8507688-8507710 CCGCACTACCTCTCCAGCAATGG - Intergenic
1095234614 12:39781840-39781862 CCTCACATACCCTGGAGGAAGGG + Intronic
1095384799 12:41638054-41638076 CTCCACATCCTCTCCAGCACCGG + Intergenic
1096484694 12:51971011-51971033 CCTCAGACCCTCACCAGGAGGGG - Intronic
1097530380 12:60792560-60792582 CCCCATATCCTCTCCAGCACCGG + Intergenic
1098565358 12:71929170-71929192 CTCCACATCCTCTCCAGCATCGG - Intergenic
1098723781 12:73936122-73936144 CCTCACATCCTCTTCTGGAGTGG + Intergenic
1099045123 12:77707701-77707723 CTCCACATCCTCTCCAGCACCGG + Intergenic
1101163644 12:102005804-102005826 CTTCACATGGTCTCCAGGTAAGG - Intronic
1101579900 12:106033147-106033169 CCTCACATCCTACCCAGGTTGGG + Intergenic
1101945658 12:109134411-109134433 TCCTACATCCTCCCCAGGAAAGG - Intronic
1102540325 12:113614319-113614341 CCTCACAACCATTCCAAGAAGGG + Intergenic
1102575925 12:113856122-113856144 ACTCACAGCCTCTCCGGGACTGG - Intronic
1102778934 12:115546736-115546758 CCTGAGAGACTCTCCAGGAAGGG + Intergenic
1103081976 12:118031403-118031425 CTGCCCATCCTCTCCTGGAAGGG - Exonic
1103747722 12:123137303-123137325 CCCCAGAACCTCTTCAGGAAAGG + Intronic
1104276320 12:127331691-127331713 CCTCTCATCCTCTACAGGCATGG - Intergenic
1104625178 12:130346963-130346985 CCTCACATCCTCTCCATTCCGGG - Exonic
1104886807 12:132115035-132115057 TCTCTGATCCTCACCAGGAAGGG - Intronic
1104957234 12:132472852-132472874 GCCCACGTCCTCTCCAGGAGGGG - Intergenic
1104957247 12:132472892-132472914 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957269 12:132472974-132472996 GCCCACGTCCTCTCCAGGAGGGG - Intergenic
1104957280 12:132473015-132473037 GCCCACGTCCTCTCCAGGAGGGG - Intergenic
1104957294 12:132473056-132473078 GCCCACGCCCTCTCCAGGAAGGG - Intergenic
1104957316 12:132473137-132473159 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957327 12:132473177-132473199 GCCCACGTCGTCTCCAGGAAGGG - Intergenic
1104957353 12:132473257-132473279 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957366 12:132473298-132473320 GCCCACGCCCTCTCCAGGAAGGG - Intergenic
1104957376 12:132473339-132473361 GCCCACGTCCTCTCCAGGAGGGG - Intergenic
1104957389 12:132473380-132473402 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957401 12:132473420-132473442 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957414 12:132473461-132473483 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957426 12:132473502-132473524 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957438 12:132473542-132473564 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957449 12:132473582-132473604 GCCCACGTCGTCTCCAGGAAGGG - Intergenic
1104957461 12:132473623-132473645 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957473 12:132473664-132473686 GCCCACGTCCTCTCCAGGAGGGG - Intergenic
1104957486 12:132473705-132473727 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957498 12:132473746-132473768 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957510 12:132473786-132473808 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957521 12:132473826-132473848 GCCCACGTCGTCTCCAGGAAGGG - Intergenic
1104957546 12:132473906-132473928 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957556 12:132473947-132473969 GCCCACGTCCTCTCCAGGAGGGG - Intergenic
1104957580 12:132474029-132474051 GCCCACGTCCTCTCCAGGAGGGG - Intergenic
1104957603 12:132474111-132474133 GCCCACGTCCTCTCCAGGAGGGG - Intergenic
1104957616 12:132474151-132474173 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1104957628 12:132474191-132474213 GCCCACGTCCTCTCCAGGAAGGG - Intergenic
1106978551 13:35251337-35251359 CCTCACATCCTCACCAGCCTTGG + Intronic
1107440068 13:40418726-40418748 CTCCACATCCTCTCCAGCATCGG - Intergenic
1108548086 13:51516118-51516140 CTCCACATCCTCTCCAGCACCGG + Intergenic
1110217097 13:73035052-73035074 CCTCCCACCCCCTCCAGGGATGG - Intergenic
1111861904 13:93718250-93718272 CTCCACATCCTCTCCAGCACCGG + Intronic
1111937748 13:94573786-94573808 CCTCTCTTTCTCTCCAGAAAGGG + Intergenic
1118005603 14:61562158-61562180 CCCCACCTCCTCTCCAGGGAGGG + Intronic
1118500192 14:66355205-66355227 TCTCACTCCCTTTCCAGGAAGGG - Intergenic
1120393976 14:83944435-83944457 CCTCCCAGCCTCTCCAGCCATGG - Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1123427765 15:20186396-20186418 ACTCACATTCTCTGAAGGAACGG - Intergenic
1123537002 15:21192943-21192965 ACTCACATTCTCTGAAGGAACGG - Intergenic
1125289571 15:38130838-38130860 CCACACTTCCTCTCTAGGAGAGG + Intergenic
1126239976 15:46430403-46430425 CTCCACATCCTCTCCAGCACAGG - Intergenic
1126339140 15:47620345-47620367 CCTCACACCCTCTGGAGGCAGGG + Intronic
1127259163 15:57315640-57315662 CCTCACATCCTCACCAGCACTGG + Intergenic
1127838031 15:62806499-62806521 ACTCACTTCCTCACCAGGGATGG - Intronic
1128532219 15:68462186-68462208 GCTCACATTCTCTCCTGGAAGGG + Intergenic
1129265526 15:74391353-74391375 GTTCACATCCTCTCCAGGCCTGG - Intergenic
1131168749 15:90161569-90161591 CCTCCCAACCTCTCCTGGAGGGG + Intronic
1132437511 15:101821175-101821197 CCTCCCACCCCCTCCAAGAAAGG - Intergenic
1134094870 16:11412641-11412663 TCCCTCATCCTCTCCAGGCAGGG - Intronic
1136174346 16:28506972-28506994 CCTCCCACCCCCTCCGGGAAGGG - Intronic
1136545843 16:30954178-30954200 CTTCACATCCTGTATAGGAATGG - Exonic
1136743532 16:32561933-32561955 CTCCACATCCTCTCCAGCACCGG - Intergenic
1136856534 16:33663375-33663397 ACTCACATTCTCTGAAGGAACGG + Intergenic
1137025217 16:35467268-35467290 AGACACATCCTGTCCAGGAAAGG - Intergenic
1140261288 16:73382745-73382767 CCTCACATACCCTCAAGGAAAGG - Intergenic
1141049225 16:80745538-80745560 CCTCACACCAACTCCATGAAGGG - Intronic
1141445460 16:84055112-84055134 CCACACGTCCCCTCCATGAAGGG - Intronic
1141451477 16:84106511-84106533 CCTCACACACACACCAGGAATGG - Intronic
1141595197 16:85093019-85093041 TATCACATGCTCTCCAGGAAAGG + Exonic
1141884327 16:86881337-86881359 CCCCACATCCTCACCAGCACTGG + Intergenic
1142201215 16:88761982-88762004 CCCCGCAGCCTCTCCAGAAAGGG + Intronic
1203026066 16_KI270728v1_random:513296-513318 CTCCACATCCTCTCCAGCACCGG + Intergenic
1203045655 16_KI270728v1_random:821135-821157 CTCCACATCCTCTCCAGCACCGG - Intergenic
1203118112 16_KI270728v1_random:1511852-1511874 ACTCACATTCTCTGAAGGAACGG + Intergenic
1142532719 17:593660-593682 CTCCACATCCTCTCCAGCACCGG - Intronic
1143140225 17:4738459-4738481 CCCCACACACGCTCCAGGAAAGG + Exonic
1143417551 17:6760649-6760671 CCTTGCATCCCATCCAGGAAAGG - Intronic
1143779348 17:9221257-9221279 CCTCCCATCCTCCCCAGACAAGG - Intronic
1143811098 17:9472479-9472501 CCTCAGTGCCTCTGCAGGAAGGG - Intronic
1144675307 17:17158114-17158136 CCTCACAGCCTCTTCAGTCAAGG + Intronic
1145749253 17:27343428-27343450 CCTGACATCCCATCCAGGAGTGG - Intergenic
1145914461 17:28563425-28563447 CCTCACTTCTTCCCCAGGTAAGG - Exonic
1147423016 17:40331921-40331943 CCTCTCATCCTCCCCACAAAGGG - Intronic
1148857079 17:50584677-50584699 TCTCTCTTCCTCTCCTGGAAGGG - Intronic
1150005059 17:61464032-61464054 CCCCACCCCCTCTCCAGGAATGG - Intronic
1152237328 17:79145400-79145422 CCTCAGACCCTCTCCAGGGAGGG - Intronic
1152895377 17:82907882-82907904 CCTCCCACCCTCCCCAGGCAGGG + Intronic
1153415391 18:4840733-4840755 ACTCAGATCCTTTCCAGGATAGG + Intergenic
1153602976 18:6800210-6800232 CTCCACATCCTCTCCAGCATCGG - Intronic
1156037914 18:32786469-32786491 CAGCACATACTCTCCAAGAAAGG - Intergenic
1156187883 18:34684787-34684809 CTCCACATCCTCTCCAGCATCGG + Intronic
1156304728 18:35866737-35866759 CTCCACATCCTCTCCAGCACCGG + Intergenic
1156968543 18:43126978-43127000 AATCACATCCTCTCCAGCCAGGG - Intergenic
1158779453 18:60629118-60629140 CTCCACATCCTCTCCAGCACCGG + Intergenic
1159558074 18:69965944-69965966 CTCCACATCCTCTCCAGCACCGG - Intergenic
1161902366 19:7129018-7129040 AATCACATCCACTCCTGGAATGG + Intronic
1163850765 19:19662113-19662135 CTTAACTTCCTCTCCAGGGATGG - Intronic
1163989998 19:20989281-20989303 CCACAACTCCTCTCCAGCAAGGG + Intergenic
1165393422 19:35550994-35551016 CCTCACAGCCTCTCACCGAATGG + Exonic
1166743131 19:45126182-45126204 CCTCACAGGCTCTGCAGGGAAGG - Intronic
1166804037 19:45474192-45474214 CCTCACATCCTCTCCAGGAAGGG + Exonic
1168408237 19:56121530-56121552 CCGCACCTCCTGTCCGGGAAGGG - Intergenic
925313198 2:2902476-2902498 CCTCACTCCCACTCCAGGAAAGG + Intergenic
926144290 2:10387249-10387271 CCTCACGGCCTCCTCAGGAAGGG + Intronic
926400772 2:12493743-12493765 CCTCAGTTTCTCTCCAGGAAAGG - Intergenic
926853745 2:17229366-17229388 CCACACATGCTCTCCTGGAAAGG + Intergenic
927896649 2:26786816-26786838 CCTAACAGCCTCTCCCGGAAGGG - Intronic
928125361 2:28611836-28611858 CCTGACATCCTTTCAAGGAGAGG - Intronic
928238936 2:29569824-29569846 CCCCACATCCACTCTAGGAGGGG + Intronic
928277569 2:29916916-29916938 CTTCACCTCTTCTCCATGAATGG + Intronic
928475550 2:31623476-31623498 CCTCAACACCTCTCCAGCAAGGG - Intergenic
928767921 2:34670404-34670426 CCTTTCTTCCCCTCCAGGAAAGG + Intergenic
929468825 2:42170111-42170133 CCTCATTCCCTCTTCAGGAAGGG + Intronic
929509344 2:42554734-42554756 CCTCACAGCCTCTCTGAGAAGGG + Intronic
930572903 2:53109565-53109587 CCTGACCTCTTCTCCAGGAACGG - Intergenic
932392807 2:71412115-71412137 CTCCACATCCTCTCCAGCACCGG + Intronic
932885160 2:75542760-75542782 CCCTACATCTTCTCCATGAAGGG - Intronic
935098560 2:99970587-99970609 CCTCATAGCCTCTCCAGGCATGG + Intronic
935449389 2:103191108-103191130 CCACACCACCTCTCCAGCAAGGG + Intergenic
935475643 2:103518621-103518643 CTCCACATCCTCTCCAGCACCGG - Intergenic
935485647 2:103650271-103650293 ATTCACATCTTCACCAGGAAAGG - Intergenic
936058026 2:109276006-109276028 CATGAAATCCTCTCCAGGATTGG - Intronic
936402983 2:112180343-112180365 CTCCACAACCTCTCCAGGATCGG - Intronic
936520212 2:113207233-113207255 ACTCTCATCCTCTCCAGAAGTGG - Intronic
937267561 2:120626086-120626108 CCTCCCCTTCTCTCTAGGAAGGG - Intergenic
938200705 2:129370347-129370369 CTTCACATCCTCTCCAGCACTGG + Intergenic
938721688 2:134072670-134072692 CCTCAGAGCTCCTCCAGGAAAGG - Intergenic
938739287 2:134215847-134215869 ACTCACATCCTCTCCATGGTTGG + Intronic
939247956 2:139649234-139649256 TCACAACTCCTCTCCAGGAAGGG + Intergenic
940739786 2:157493937-157493959 TCTTTCCTCCTCTCCAGGAATGG - Intergenic
943074219 2:183175007-183175029 CTCCACATCCTCTCCAGCATCGG + Intergenic
945231486 2:207594860-207594882 CCTCACATCCTCATCAACAATGG + Intronic
946485158 2:220094535-220094557 CCTCACATCAAGCCCAGGAAAGG - Intergenic
946766471 2:223045268-223045290 CCCCACATCTTCCCCAGGAAGGG + Intergenic
947114506 2:226754305-226754327 CCCCACACTCACTCCAGGAATGG - Intronic
947233724 2:227918586-227918608 CCTCTCACCCTCTCCTGCAATGG + Intronic
948064475 2:235066958-235066980 CCTCCCCTCCTCTCCAGACACGG - Intergenic
1168807731 20:682563-682585 CCTCACAGCCTTAACAGGAAGGG + Intergenic
1168875723 20:1171031-1171053 CCTCACATCCTCTCTAGGTGAGG + Intronic
1169695644 20:8384559-8384581 CCTCAATGCCTCTCCAGCAAGGG - Intronic
1170141695 20:13131343-13131365 CCTGACATCTGCTCCATGAATGG + Intronic
1170518883 20:17162371-17162393 CCAAAGATCCTCTCCAGAAAGGG - Intergenic
1170801029 20:19590505-19590527 CCTAACATCCATTCCAGGGAGGG + Intronic
1171127138 20:22612185-22612207 CCCCACCTCCCATCCAGGAAGGG - Intergenic
1171298550 20:24039782-24039804 CCTCACCTCCTCAGCAGGCATGG - Intergenic
1171439919 20:25151880-25151902 CCCCAGACCCTCTTCAGGAAAGG - Intergenic
1172554233 20:35827012-35827034 CCCCATCTCCTCTCCAGCAAAGG + Intronic
1173427535 20:42955990-42956012 TCTCCCTTCCTCTCCTGGAAGGG - Intronic
1174335743 20:49859182-49859204 CCTCACAAACTCTCCAGCCACGG + Intronic
1174655038 20:52164479-52164501 GCTCACATCCTCTCCAGAGCTGG + Intronic
1175033881 20:55981534-55981556 CCTCCCACCCTCTTCAGGGAAGG + Intergenic
1175808581 20:61845247-61845269 CCTCACACCCTCTCTAGGCTGGG + Intronic
1176246741 20:64101037-64101059 CCTCAGATCTGCTCAAGGAAGGG - Intergenic
1178906594 21:36642068-36642090 CCTCAAATCATCTGCAGGCAGGG - Intergenic
1182660798 22:31923898-31923920 CATCTGATCCTCTCCAGGGAGGG - Intergenic
1184784971 22:46667187-46667209 CCCCACAACCTCCCCAGGTAGGG + Intronic
949894253 3:8757713-8757735 TCTCCCATCCTTGCCAGGAAGGG + Intronic
950192436 3:10986921-10986943 CCTCACATCCTGTCCATTGAGGG + Intergenic
950568563 3:13786232-13786254 CCTGGAACCCTCTCCAGGAAGGG + Intergenic
950880153 3:16316879-16316901 CCTGGCATCCTCTCCAGGATTGG + Exonic
951471539 3:23062066-23062088 ACACAACTCCTCTCCAGGAAGGG - Intergenic
952310139 3:32181089-32181111 CCTGAAATCCACACCAGGAAGGG + Intergenic
954459982 3:50620809-50620831 CCATACACCCTCTCCAAGAAAGG - Intronic
954480510 3:50796019-50796041 CCACACCACCTCTCCAGAAAGGG - Intronic
955577723 3:60384495-60384517 TCTCACACACACTCCAGGAAAGG + Intronic
955638163 3:61053106-61053128 CCTCCCATCCACTGCAGGGAAGG + Intronic
956353293 3:68362652-68362674 CTTCACATTCACTGCAGGAAGGG - Intronic
957352897 3:79049001-79049023 TCACACATCCTCACCAGCAAGGG + Intronic
958621608 3:96569946-96569968 CTCCACATCCTCTCCAGCATCGG + Intergenic
959040662 3:101419860-101419882 CCTCACAACCACTCCATGAGGGG + Intronic
959203849 3:103280991-103281013 CTCCACATCCTCTCCAGCACCGG + Intergenic
959806655 3:110562455-110562477 CCTCCCATCCACTTGAGGAAAGG - Intergenic
960636748 3:119792129-119792151 CCTCGCATCTTCACCAGGATCGG + Intronic
961528345 3:127523478-127523500 TCTGACAAGCTCTCCAGGAAGGG + Intergenic
964216825 3:154294463-154294485 ATTCACATACTCTCCAGCAAAGG + Intronic
966082530 3:176021491-176021513 CTCCACATCCTCTCCAGCACCGG - Intergenic
966862697 3:184239456-184239478 CCTCTCATCCCCTCCAGGCCGGG + Exonic
967715732 3:192759167-192759189 CCACATCTCCTCTCCAGCAAGGG + Intronic
967841811 3:194010974-194010996 ACTCACAGCCTCTCAACGAATGG + Intergenic
967964501 3:194950311-194950333 CCTCAGACCCTGTCCAGGACAGG - Intergenic
967995787 3:195165344-195165366 CCTGAGATCCTCTCCCAGAAAGG + Intronic
969262021 4:6039719-6039741 CCTCACAGCCTCGACAGGAAGGG + Intronic
969264239 4:6054742-6054764 CCTCACCTTCTGTCCAAGAAGGG + Intronic
969522347 4:7685831-7685853 CCACACAGCCTCTCAATGAATGG + Intronic
969671759 4:8593566-8593588 CCTCACGGCCTCTCCAGGTGTGG + Intronic
970927829 4:21473418-21473440 TTTTACAGCCTCTCCAGGAAGGG - Intronic
972468112 4:39377463-39377485 CTCCACATCCTCACCAGCAATGG + Intergenic
972691819 4:41406512-41406534 CCTCCCTCCCTCTCCAGGGAGGG + Intronic
973159229 4:46994291-46994313 TCTCCCCTCCTCTCCAGAAAAGG - Exonic
974055270 4:56977476-56977498 GCGCACCTCCTCTCCAGGAGCGG + Exonic
974143999 4:57923578-57923600 CTCCACATCCTCTCCAGCACCGG - Intergenic
976684670 4:87798881-87798903 CCTCACATGCACGACAGGAAGGG + Intergenic
976992236 4:91381773-91381795 ACTCAGATCCTCACCAGCAATGG - Intronic
981173581 4:141654004-141654026 CCTCACATTTTCTCAAGGAATGG + Intronic
981774953 4:148355625-148355647 GCTCTCATCCCCTACAGGAAGGG + Intronic
982166064 4:152614562-152614584 CCTCACACCCTCCCCAGGGCAGG + Intergenic
986100403 5:4603779-4603801 CCTCACATTTTCTCAAGTAATGG + Intergenic
986444294 5:7807889-7807911 ATCCACATCCTCTCCAGGTATGG + Intronic
986629201 5:9753188-9753210 CTCCACATCCTCTCCAGCACCGG + Intergenic
986891955 5:12320252-12320274 CCCCACAACCTCTCCAGCAGTGG + Intergenic
986902623 5:12455213-12455235 CTTTAAATCCTCTCCAGTAAGGG - Intergenic
988970924 5:36466339-36466361 TCACAACTCCTCTCCAGGAAGGG + Intergenic
990079096 5:51890549-51890571 CTTCACACTCTCTCCAGGATTGG + Intergenic
990629199 5:57649514-57649536 CTCCACAACCTCTCCAGAAATGG + Intergenic
991045295 5:62216695-62216717 ACTCACATTCTCTGAAGGAACGG - Intergenic
991191354 5:63878068-63878090 CCTCACACCCTCACAAGGCAAGG + Intergenic
993365416 5:87029487-87029509 GATCACAACCTCTCCAGCAAGGG - Intergenic
993862133 5:93149118-93149140 CTCCACATCCTCTCCAGCACCGG - Intergenic
995258527 5:110074803-110074825 CCACACTACCTCTCCAGCAAGGG - Intergenic
995321108 5:110835259-110835281 CTCCACATCCTCTCCAGCACCGG - Intergenic
996521269 5:124428636-124428658 CTCCACATCCTCTCCAGCACTGG - Intergenic
996527153 5:124491573-124491595 TCACAAATCCTCTCCAGCAAGGG - Intergenic
997476444 5:134145242-134145264 CCTCACTTCCTCTTCAAGATGGG + Intronic
997615088 5:135240674-135240696 CCAAAGAGCCTCTCCAGGAAAGG - Intronic
997999840 5:138616314-138616336 CCTCACATCCCCCCTATGAAGGG - Intronic
998462672 5:142321173-142321195 CCACACCTCCTGTGCAGGAAAGG + Intronic
998689541 5:144571857-144571879 CTCCACATCCTCTCCAGCACTGG + Intergenic
999149899 5:149420020-149420042 CCCCACTTCCTCCCCAGGGAGGG - Intergenic
999223289 5:149999526-149999548 CCTCACATCCGGTCCAGCACAGG - Intronic
999231574 5:150065148-150065170 CCTCCCATCCTCCCCACCAAAGG + Intronic
1000041161 5:157486275-157486297 CCTCACAGCCATTCCAAGAAGGG - Intronic
1001933880 5:175691249-175691271 CCTGACTTCCTCTCCAGGAGTGG - Intergenic
1002946103 6:1762684-1762706 TTTCTCATCCTCCCCAGGAAGGG - Intronic
1003437060 6:6100319-6100341 CTCCACATCCTCTCCAGCACTGG + Intergenic
1004160449 6:13208178-13208200 CCTCACATCATCTACGGAAACGG + Intronic
1004885548 6:20048344-20048366 CCTCACTTCCACCCCAGTAATGG - Intergenic
1005778242 6:29161059-29161081 TCTCAACTCCTCTCCAGCAAGGG - Intergenic
1005828611 6:29652301-29652323 CCTCCCAGCCTCCCCAGGACTGG + Intergenic
1006880182 6:37332311-37332333 CCTAGCAGCCTCCCCAGGAAGGG + Exonic
1006996891 6:38269679-38269701 CCTCACATCTTCTGCAGCAGTGG - Intronic
1007228945 6:40334798-40334820 CCTCCTCTCCTCTCAAGGAAAGG + Intergenic
1008751433 6:54737797-54737819 CTTCACATCCTCACCAAGATGGG + Intergenic
1009260166 6:61476322-61476344 CTCCACATCCTCTCCAGCACTGG - Intergenic
1009333641 6:62457634-62457656 CTCCACATCCTCTCCAGCATTGG + Intergenic
1010487785 6:76436244-76436266 CTCCACATCCTCTCCAGCACAGG - Intergenic
1010707163 6:79128390-79128412 ACTCACTACCTCTCCAGCAAGGG + Intergenic
1010990531 6:82474991-82475013 CTCCACATCCTCTCCAGCACCGG - Intergenic
1013025165 6:106263947-106263969 TCTCAATTCCTCTCCAGCAAGGG + Intronic
1013910670 6:115272536-115272558 CATCCCAGCCTCTCCAGCAATGG + Intergenic
1014385183 6:120791981-120792003 CTCCACATCCTCTCCAGCATTGG + Intergenic
1014779703 6:125550137-125550159 CCACACATCCCTACCAGGAAAGG + Intergenic
1014807615 6:125848151-125848173 CTCCACATCCTCTCCAGCATTGG - Intronic
1015678988 6:135782312-135782334 CCACACTACCTCTCCAGCAAGGG + Intergenic
1017236293 6:152120369-152120391 GCTCACAGCCTCTCCAGAAGCGG + Intronic
1018805929 6:167259395-167259417 CCACAACTCCTCTCCAGCAAGGG + Intergenic
1020382142 7:7558066-7558088 CCACACCACCTCTCCAGCAAGGG + Intergenic
1022079251 7:27003087-27003109 CTCCACATCCTCTCCAGCACCGG + Intergenic
1022454770 7:30548771-30548793 CCTCACATCCTCTTAAGGCTTGG - Intronic
1024125929 7:46294783-46294805 TCTCCCATCCAATCCAGGAAAGG - Intergenic
1026879190 7:73897892-73897914 GCTCACCTTCTCTCCAGGACCGG + Intergenic
1028336805 7:89668004-89668026 CCACACCACCTCTCCAGCAAGGG + Intergenic
1029595497 7:101535535-101535557 CCTGACACCCTCTCCACCAAGGG + Intronic
1031045793 7:116885926-116885948 CCTAACCTCCACTCCAGGGAGGG - Intronic
1032147274 7:129395474-129395496 CCTCTCCAGCTCTCCAGGAAGGG - Intronic
1032262062 7:130346280-130346302 CAGCACATCCTCTCCTGGGAAGG - Intronic
1032478996 7:132231730-132231752 CCACACATCTTCTCCATGACTGG + Intronic
1033973955 7:147076271-147076293 CTCCACATCCTCTCCAGCACCGG + Intronic
1034310528 7:150083837-150083859 CTACACATCCTCTCCAATAAAGG - Intergenic
1035134151 7:156684385-156684407 CCTCACGTGCTGTCCTGGAAGGG - Intronic
1035653307 8:1285463-1285485 CCTTCCATCATCTCCAGGACAGG - Intergenic
1035736536 8:1891508-1891530 CCTCATGTCCTCACCGGGAATGG - Intronic
1035754402 8:2021040-2021062 CTGCACATCCTCACAAGGAAAGG - Intergenic
1036168598 8:6460950-6460972 TCACCCATCGTCTCCAGGAATGG - Intronic
1036706516 8:11050949-11050971 CCTCACATCTCCTCCAGCTATGG + Intronic
1036714650 8:11109551-11109573 CATCTCATCCTCCCCAGGAAAGG + Intronic
1037948425 8:23003779-23003801 CCTCCCAGCCTCTCTAGGATGGG - Intronic
1039029895 8:33298104-33298126 CTGCACATCCTCTCCAGCAAAGG + Intergenic
1041785737 8:61631663-61631685 CCTTACATCCTCTTCTGGCAGGG + Intronic
1042271737 8:66962328-66962350 CCACTCAGCCGCTCCAGGAAAGG - Exonic
1043301770 8:78743659-78743681 CCTCATTACCTCTCCAGCAAGGG - Intronic
1044114958 8:88324701-88324723 CATCACTTCCTCTCCAGAAGAGG - Intronic
1044494400 8:92859676-92859698 CCTCTCCATCTCTCCAGGAAGGG - Intergenic
1044793643 8:95873247-95873269 CCACACCACCTCTCCAGGAAGGG + Intergenic
1045570708 8:103366432-103366454 CTCCACATCCTCTCCAGCATCGG + Intergenic
1047121434 8:121909034-121909056 CCGCAACTCCTCTCCAGCAAGGG + Intergenic
1047334127 8:123919916-123919938 CCTCCTTGCCTCTCCAGGAAAGG - Intronic
1048029440 8:130617056-130617078 CCACACCACCTCTCCAGCAAGGG + Intergenic
1048453759 8:134558260-134558282 CAGCACTTCCTCCCCAGGAATGG + Intronic
1048593620 8:135844281-135844303 CCTCACATCCAGTCCTGCAAAGG + Intergenic
1048632793 8:136262316-136262338 CCTCACATCATTTCCAGCAATGG - Intergenic
1049128261 8:140811526-140811548 CCGCACCACCTCTCCAGCAAGGG + Intronic
1049188392 8:141271518-141271540 CCACACAGCCTCTCGAGGTAGGG - Intronic
1049379319 8:142304188-142304210 CCTCCCGCCCACTCCAGGAAGGG - Intronic
1050601227 9:7253632-7253654 CTCCACATCCTCTCCAGCACCGG + Intergenic
1050942688 9:11480388-11480410 CTGCACATCCTCTCCAGCATCGG + Intergenic
1051915484 9:22201529-22201551 CCTAACATCCTCTCTTGTAATGG - Intergenic
1053415248 9:37943346-37943368 GCTCACAGCCTCACAAGGAAAGG - Intronic
1054745494 9:68850203-68850225 GGTCACGTCCTCACCAGGAAGGG - Intronic
1056015854 9:82386810-82386832 CTCCACATCCTCTCCAGCATGGG + Intergenic
1056365343 9:85899212-85899234 CCTCACATCTTCACCAGCAGCGG + Intergenic
1056637027 9:88339673-88339695 CCTCACGTCCTCTCCTGCAACGG + Intergenic
1057023088 9:91715832-91715854 CTTCACATCCTCACCAGCACTGG - Intronic
1058079126 9:100683397-100683419 CCTCACATCCTCACCAACATTGG - Intergenic
1058103127 9:100938326-100938348 CCACTCCTCCTCTCCAGGAAAGG - Intergenic
1060200497 9:121649488-121649510 CCTCCCGTCCCCTCCAGGGAGGG + Intronic
1060518221 9:124279083-124279105 CCCCCCATCCTCTCCAGGCCAGG - Intronic
1060758259 9:126228020-126228042 CCCCACATTCTCTCTAGGACTGG + Intergenic
1061320510 9:129825343-129825365 CATCACATCCTACCAAGGAAGGG + Intergenic
1061901004 9:133671947-133671969 CCTCAGGTCTTCTCCAGGACTGG + Intronic
1062325645 9:136011219-136011241 CCTCCCACCCTCCCCAAGAAGGG + Exonic
1188131341 X:26437111-26437133 CATCACAAACTCTGCAGGAATGG - Intergenic
1188956219 X:36437279-36437301 CCTCTTTTCATCTCCAGGAATGG - Intergenic
1191097317 X:56687637-56687659 TCACAATTCCTCTCCAGGAATGG - Intergenic
1191172278 X:57459950-57459972 TCACAAATCCTCTCCAGCAAGGG + Intronic
1191593265 X:62912608-62912630 CCTTACTTTCACTCCAGGAAAGG - Intergenic
1193784251 X:85739963-85739985 TCTCAACTCCTCTCCAGCAAGGG + Intergenic
1193790087 X:85807362-85807384 CCACACCACCTCTCCAGCAAGGG - Intergenic
1194193646 X:90866079-90866101 TCACACCTCCTCTCCAGCAAGGG + Intergenic
1194917756 X:99724866-99724888 CCTCATCATCTCTCCAGGAAGGG + Intergenic
1195011511 X:100736414-100736436 CCTCACATCCTCTTTAGTGAGGG - Intergenic
1196184086 X:112726732-112726754 CCTGTCATCCTCTTGAGGAAAGG - Intergenic
1196468294 X:115994603-115994625 CCACACCACCTCTCCAGCAAGGG + Intergenic
1196476311 X:116091239-116091261 TCGCAACTCCTCTCCAGGAAGGG - Intergenic
1199952393 X:152716277-152716299 CCTCACGTCCACTCCTGGCAGGG - Intronic
1199957290 X:152752171-152752193 CCTCACGTCCACTCCTGGCAGGG + Intronic
1199963551 X:152799363-152799385 ACTCACATCCACACCAGCAAAGG - Intergenic
1200540256 Y:4448461-4448483 TCACACCTCCTCTCCAGCAAGGG + Intergenic
1201563928 Y:15346693-15346715 CCTCTCCCCATCTCCAGGAAGGG + Intergenic