ID: 1166807142

View in Genome Browser
Species Human (GRCh38)
Location 19:45494266-45494288
Sequence CTCTTCCAGCAATGGCTCTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 255}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166807133_1166807142 19 Left 1166807133 19:45494224-45494246 CCTTACTGGCTCTCGCTCCAGTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG 0: 1
1: 0
2: 1
3: 28
4: 255
1166807138_1166807142 -7 Left 1166807138 19:45494250-45494272 CCCACTGCTTTTCTTCCTCTTCC 0: 1
1: 0
2: 21
3: 291
4: 2188
Right 1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG 0: 1
1: 0
2: 1
3: 28
4: 255
1166807132_1166807142 20 Left 1166807132 19:45494223-45494245 CCCTTACTGGCTCTCGCTCCAGT 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG 0: 1
1: 0
2: 1
3: 28
4: 255
1166807139_1166807142 -8 Left 1166807139 19:45494251-45494273 CCACTGCTTTTCTTCCTCTTCCA 0: 1
1: 0
2: 9
3: 249
4: 1828
Right 1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG 0: 1
1: 0
2: 1
3: 28
4: 255
1166807136_1166807142 -5 Left 1166807136 19:45494248-45494270 CCCCCACTGCTTTTCTTCCTCTT 0: 1
1: 1
2: 5
3: 112
4: 1070
Right 1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG 0: 1
1: 0
2: 1
3: 28
4: 255
1166807137_1166807142 -6 Left 1166807137 19:45494249-45494271 CCCCACTGCTTTTCTTCCTCTTC 0: 1
1: 0
2: 12
3: 145
4: 1352
Right 1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG 0: 1
1: 0
2: 1
3: 28
4: 255
1166807135_1166807142 2 Left 1166807135 19:45494241-45494263 CCAGTGGCCCCCACTGCTTTTCT 0: 1
1: 0
2: 1
3: 21
4: 338
Right 1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG 0: 1
1: 0
2: 1
3: 28
4: 255
1166807131_1166807142 21 Left 1166807131 19:45494222-45494244 CCCCTTACTGGCTCTCGCTCCAG 0: 1
1: 0
2: 1
3: 7
4: 148
Right 1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG 0: 1
1: 0
2: 1
3: 28
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166807142 Original CRISPR CTCTTCCAGCAATGGCTCTT CGG Exonic
901791050 1:11653945-11653967 CTCTTCCAGCTCTGGGCCTTGGG - Intronic
901942516 1:12674242-12674264 CTCTCCCATGAATGGCTTTTTGG + Intergenic
906322777 1:44827235-44827257 CTCGTACCGCAATGGCTCTGAGG - Exonic
907074503 1:51566181-51566203 CTCTTCCCTCCATGCCTCTTTGG + Intergenic
908102977 1:60810339-60810361 CACTTCCAGCACTGGCCCTGAGG - Intergenic
909488703 1:76202511-76202533 CTCTTCCAGTCATGGCTCTTGGG + Intronic
909670703 1:78185040-78185062 CACTTGCTGCAATGTCTCTTTGG + Intergenic
910443975 1:87282026-87282048 GACTTACAGCAATGGCTCTTGGG + Intergenic
913581907 1:120234595-120234617 CTCTACCACCAATAGCTCTTCGG - Intergenic
913626268 1:120663794-120663816 CTCTACCACCAATAGCTCTTCGG + Intergenic
914423041 1:147546869-147546891 TTCTTTCAGAAATGGTTCTTTGG - Intronic
914563838 1:148846042-148846064 CTCTACCACCAATAGCTCTTCGG - Intronic
914608989 1:149284184-149284206 CTCTACCACCAATAGCTCTTCGG + Intergenic
915287513 1:154862387-154862409 CTCCTCCAGCACTGGCTGTGTGG - Intronic
916724188 1:167508235-167508257 CTCGTCGCGCAATAGCTCTTTGG - Intronic
917065166 1:171084889-171084911 CTCCTCCATTAATGACTCTTAGG + Intergenic
918198316 1:182243390-182243412 TTCTTCAACCATTGGCTCTTAGG + Intergenic
920539166 1:206764566-206764588 CTCTTGCATCATTGGCTCTGGGG + Intergenic
922508956 1:226146763-226146785 CTCATCCAGCAAAGGCTTGTTGG + Exonic
1063628543 10:7713461-7713483 CTCTTCAACCAATGGGTTTTGGG + Intronic
1064751057 10:18529472-18529494 CTCCTGCAGCAACAGCTCTTTGG - Intronic
1065770853 10:29076786-29076808 GTTTTCCAGAAATGGCTTTTTGG + Intergenic
1066537683 10:36409645-36409667 GTTTTCCAGGAAAGGCTCTTTGG + Intergenic
1066644693 10:37594624-37594646 GTTTTCCAGGAAGGGCTCTTTGG + Intergenic
1067210791 10:44259207-44259229 CTCTTCCTGCAGGGGATCTTTGG + Intergenic
1070035672 10:72721074-72721096 CTGTTTCACCACTGGCTCTTTGG + Intronic
1070801781 10:79248171-79248193 CTCTTCCTTCTATAGCTCTTGGG - Intronic
1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG + Exonic
1072798762 10:98377172-98377194 CTCTACCAGCATTGGATTTTAGG - Intergenic
1074662619 10:115678928-115678950 CTCTTCCACCATTGTCTATTGGG - Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1076350900 10:129814559-129814581 CTCTTCTGGCAAAGGCTGTTTGG + Intergenic
1076548452 10:131261661-131261683 ATTTTCCAGCAGTAGCTCTTTGG + Intronic
1077145598 11:1042871-1042893 CTCTGCCAGCAATGGCGTTGGGG + Intergenic
1078475220 11:11623396-11623418 CTCTTCCAGCTATGGATCAAGGG - Intergenic
1078652870 11:13212311-13212333 AGATACCAGCAATGGCTCTTAGG + Intergenic
1078796144 11:14593514-14593536 TTCTTCCCACCATGGCTCTTAGG - Intronic
1082672038 11:56046037-56046059 CTCTTCCAGAAATGGCCTTAGGG + Intergenic
1082730517 11:56790742-56790764 CCCTTGCAGCAGTGGTTCTTTGG - Intergenic
1084093257 11:66893290-66893312 CTCTGTCAGGAGTGGCTCTTAGG - Intronic
1084226250 11:67716189-67716211 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1084312357 11:68324451-68324473 CTCGGCCAGCCATGGCTCTCTGG - Intronic
1084809277 11:71602897-71602919 CTCTTCCCTCCCTGGCTCTTAGG + Intronic
1084809303 11:71602977-71602999 CTCTTCCCCCACTGGCTCTTAGG + Intronic
1085150746 11:74251286-74251308 CTCTTCCATCTCTGGCTTTTGGG - Intronic
1090667519 11:128924646-128924668 CTCCTCCGGCAAGGGCTCTGGGG + Intergenic
1090797278 11:130146083-130146105 CTCTTCCAGAAATGACGCTGAGG + Intergenic
1091707667 12:2709762-2709784 CTCTTCAACAAATGGTTCTTGGG + Intergenic
1091780718 12:3213110-3213132 CCCTTTTAGCAATGGCACTTTGG + Intronic
1091947762 12:4563482-4563504 CTCCACCAGCATTTGCTCTTTGG - Intronic
1092435989 12:8447095-8447117 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1092537285 12:9402595-9402617 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1092537974 12:9404660-9404682 CTCTTCCCCCACTGGCTTTTGGG + Intergenic
1092538624 12:9406538-9406560 CTCTTCCTCCCCTGGCTCTTAGG + Intergenic
1092538681 12:9406698-9406720 CTCTTCCCCCCGTGGCTCTTAGG + Intergenic
1092538774 12:9407012-9407034 CTCTTCCCCCACTGGCTTTTGGG + Intergenic
1092538984 12:9407919-9407941 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1092556442 12:9567001-9567023 CTCTTCCCCCGCTGGCTCTTAGG - Intergenic
1092556753 12:9568569-9568591 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1092556905 12:9569315-9569337 CTCTTCCCCCACTGGCTCTTGGG - Intergenic
1092556931 12:9569392-9569414 CTCTTCCCCCTCTGGCTCTTGGG - Intergenic
1092557031 12:9569712-9569734 CTCTTCCTCCCCTGGCTCTTAGG - Intergenic
1092557123 12:9569992-9570014 CTCTTCCCCCCCTGGCTCTTGGG - Intergenic
1094129586 12:27060923-27060945 ATCCTACACCAATGGCTCTTTGG + Intronic
1094514368 12:31118760-31118782 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1094514584 12:31119523-31119545 CTCTTCCTCCCGTGGCTCTTAGG + Intergenic
1094514696 12:31119843-31119865 CTCTTCCCCCACGGGCTCTTAGG + Intergenic
1094514786 12:31120155-31120177 CTCTTCCCCCACTGGCTCTTGGG + Intergenic
1094515213 12:31121751-31121773 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1094515458 12:31122813-31122835 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1094515648 12:31123639-31123661 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1096403021 12:51323349-51323371 CTGCTCCAGCACTGGCACTTAGG - Intronic
1096622582 12:52873965-52873987 CTCTTCCCGGAATGTCTCTGCGG - Intergenic
1100252266 12:92839755-92839777 CTCACCCAAAAATGGCTCTTTGG + Intronic
1101597862 12:106183242-106183264 ATCTTCCTGCTTTGGCTCTTTGG + Intergenic
1103897887 12:124286033-124286055 CTGTTCCTGCAAAGGCTCTGAGG - Intronic
1106895401 13:34294911-34294933 CTCTGCAAACACTGGCTCTTCGG + Intergenic
1107837778 13:44425664-44425686 GTCCTCCAGCACTGGCTTTTCGG + Intergenic
1107940479 13:45377568-45377590 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1107940531 13:45377727-45377749 CTCTTCCCCCTCTGGCTCTTAGG - Intergenic
1107941121 13:45380271-45380293 CTCTTCCGCCACCGGCTCTTAGG - Intergenic
1107941451 13:45381487-45381509 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1107941510 13:45381651-45381673 CTCTTCCCCCTCTGGCTCTTAGG - Intergenic
1107941539 13:45381732-45381754 CTCTTCCCCCTCTGGCTCTTAGG - Intergenic
1107941650 13:45382049-45382071 CTCTTCCCCCTCTGGCTCTTAGG - Intergenic
1107941792 13:45382444-45382466 CTCTTCCCCCTCTGGCTCTTAGG - Intergenic
1107942127 13:45384019-45384041 CTCTTCCCCCTCTGGCTCTTAGG - Intergenic
1108052539 13:46460581-46460603 CTCTCCCACCCCTGGCTCTTAGG + Intergenic
1108053381 13:46465463-46465485 CTCTTCCGCCACAGGCTCTTAGG + Intergenic
1108053436 13:46465621-46465643 CTCTTCCCCCTCTGGCTCTTAGG + Intergenic
1108053840 13:46467378-46467400 CTCTTCCCCCTCTGGCTCTTAGG + Intergenic
1108684761 13:52809259-52809281 TTCTTCAAGCAAGGGCTATTGGG + Intergenic
1109201737 13:59439122-59439144 TTCTTACAGCAATGGCTTTTAGG + Intergenic
1109537136 13:63737532-63737554 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1109537635 13:63739530-63739552 CTCTTCCCCCCCTGGCTCTTGGG - Intergenic
1109537665 13:63739612-63739634 CTCTTCCCCCCCTGGCTCTTGGG - Intergenic
1109537971 13:63741101-63741123 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1109538120 13:63741577-63741599 CTCTTCCACCCCTGGCTCTTAGG - Intergenic
1109545493 13:63837482-63837504 CTCTTCCTCCGCTGGCTCTTAGG + Intergenic
1109545824 13:63838783-63838805 CTCTTCCCCCCTTGGCTCTTGGG + Intergenic
1109545850 13:63838865-63838887 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1109546159 13:63840358-63840380 CTCTTCCCCCACTGGCTCTTGGG + Intergenic
1109546188 13:63840439-63840461 CTCTTCCCCCCCTGGCTCTTGGG + Intergenic
1109546296 13:63840751-63840773 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1109546324 13:63840832-63840854 CTCTTCCCCCGCTGGCTCTTAGG + Intergenic
1109546478 13:63841306-63841328 GTCTTCCACCCCTGGCTCTTCGG + Intergenic
1109546642 13:63842129-63842151 CTCTTCCCCCCCTGGCTCTTGGG + Intergenic
1109547073 13:63844016-63844038 CTCTTCCCCCCTTGGCTCTTGGG + Intergenic
1110891576 13:80704491-80704513 CTCTTCCCCCCCTGGCTCTTGGG + Intergenic
1110891781 13:80705400-80705422 CTCTTCCACCCCTGGCTCTTGGG + Intergenic
1110892027 13:80706149-80706171 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1110892236 13:80707052-80707074 CTCTTCCCCCACTGCCTCTTAGG + Intergenic
1110892312 13:80707291-80707313 CTCTTCCACCCCTGGCTTTTAGG + Intergenic
1110892334 13:80707371-80707393 CTCTTCCCCCACTGGCTCTTAGG + Intergenic
1110892367 13:80707452-80707474 CTCTTCCCCCCCTGGCTCTTGGG + Intergenic
1115684965 14:35787346-35787368 CTTTTCCATCAATTGTTCTTAGG - Intronic
1116956876 14:50932991-50933013 CTCTTTGAGCTGTGGCTCTTCGG + Intronic
1117316946 14:54580455-54580477 CTGTTCCAGCAATGTCTTCTTGG + Intronic
1118465065 14:66023430-66023452 CTGTGCCAGGAATGGCTCTAAGG + Intergenic
1121815881 14:96928409-96928431 CTCTTTCAGCACTTTCTCTTGGG + Intronic
1126227862 15:46292081-46292103 CTCTTCCATCAGTGGGTCATAGG + Intergenic
1126582098 15:50251464-50251486 CCATTCCAGCAGTGGCCCTTTGG - Intronic
1129276556 15:74449418-74449440 CACCTCCAGCAATAGTTCTTGGG + Intronic
1132074951 15:98812179-98812201 CTCTGGGAGCCATGGCTCTTGGG + Intronic
1132310949 15:100857750-100857772 CTTTCCCAGTTATGGCTCTTAGG + Intergenic
1133512366 16:6472340-6472362 ATCTTCTAGGGATGGCTCTTGGG - Intronic
1133529845 16:6645039-6645061 CTCTCCCAGCAAAGGTTCTGGGG + Intronic
1135127092 16:19820000-19820022 CTCTTCAACAAATGGCTCTGGGG + Intronic
1139255783 16:65541057-65541079 CTGTTCCAGCATTGGCCCCTGGG + Intergenic
1141606445 16:85156588-85156610 CACTCCCAGCCATGGCTTTTTGG - Intergenic
1144522944 17:15966490-15966512 CTCCTCCTGCACTGGCTCTGTGG - Intronic
1146509561 17:33434720-33434742 CTTTACTATCAATGGCTCTTTGG - Intronic
1149891070 17:60391457-60391479 CCCTTCCAGCTAAGGCTGTTAGG + Intronic
1150691850 17:67373795-67373817 CAGTTCCAGCATTGGCTGTTGGG - Intergenic
1150753694 17:67890519-67890541 CTGTCCCAGGACTGGCTCTTTGG - Intronic
1150959614 17:69899543-69899565 CTCTTCCAACAAGGCTTCTTAGG - Intergenic
1154094641 18:11401095-11401117 TCCTTCCACCAATGGCTCTATGG - Intergenic
1156406669 18:36789143-36789165 CTTTTGCAGCCATGGCTCATAGG - Intronic
1157420666 18:47545187-47545209 TTCTTCCAGCAATGACTGTCAGG - Intergenic
1157609897 18:48949757-48949779 TTCTTCCAGCACTGGCGCTCCGG + Intronic
1161266542 19:3367031-3367053 CCCCTCCAGCAAGGGCTCTGCGG + Intronic
1163005219 19:14393248-14393270 CTCTATCAGCAATGGCTAATGGG + Intronic
1164733192 19:30521124-30521146 CTCTGCTAGCACTGGCTCTGTGG - Intronic
1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG + Exonic
925038367 2:709581-709603 TTCATCCAGCGATGGCTCCTGGG + Intergenic
925516319 2:4686815-4686837 CTTTTCCAGCAGAGGGTCTTTGG + Intergenic
926467210 2:13205906-13205928 CACTTCCAGCCATGGCTCAAAGG + Intergenic
926965320 2:18403367-18403389 CTCTGCTTGTAATGGCTCTTTGG + Intergenic
928329763 2:30348633-30348655 CTCTCCCATCAAGGACTCTTCGG + Intergenic
932639246 2:73426339-73426361 AGCTTTCAGCAATGTCTCTTGGG - Intronic
933322340 2:80792593-80792615 CTCTTCCAGAATTGGATCTTAGG - Intergenic
935902242 2:107805470-107805492 CTCCTCCAGCAATCCCACTTTGG + Intergenic
937043413 2:118837774-118837796 CTCTGCCAGCTGTAGCTCTTGGG - Intergenic
941629347 2:167866696-167866718 CTCTTCCAGGAGAGGCTTTTGGG + Intergenic
945249126 2:207748509-207748531 CATTTCCAGCAAAGGCTCTCAGG + Intronic
945372092 2:209031568-209031590 TTCTTCCAGCTTTGGCCCTTGGG - Intergenic
947087834 2:226475509-226475531 TTCTTAGAGGAATGGCTCTTAGG + Intergenic
947710336 2:232310110-232310132 CTCTGCAATGAATGGCTCTTAGG - Intronic
1169712733 20:8582620-8582642 CTCATCCATCAATGGATATTTGG - Intronic
1170376004 20:15700439-15700461 ATCTTGCAGCAAAGGCACTTCGG - Intronic
1170536685 20:17347459-17347481 CACTTCCATCAATCGCTTTTGGG + Intronic
1172618364 20:36305071-36305093 CTCTTCCAGGAAGCCCTCTTGGG + Intergenic
1172783846 20:37452971-37452993 CTCATTCAGCAATGTGTCTTGGG + Intergenic
1173835062 20:46119415-46119437 CACCTGAAGCAATGGCTCTTAGG + Intronic
1174055515 20:47795512-47795534 CTCACCCTGCGATGGCTCTTGGG + Intergenic
1174290651 20:49506093-49506115 CTCATCCAGCATTTGCTCCTGGG + Exonic
1175472850 20:59244947-59244969 TTGATCCAGCAATTGCTCTTTGG - Intronic
1175504548 20:59472334-59472356 CTCATCCTGCAGTGGGTCTTGGG - Intergenic
1179286242 21:39979562-39979584 CTCTCCCAGCAAATCCTCTTAGG + Intergenic
1179630542 21:42675508-42675530 CATTTCCAGGAATGGCTCTTAGG - Intronic
1180699016 22:17771784-17771806 ACCTGCCAGCAGTGGCTCTTGGG + Intronic
1182984194 22:34701032-34701054 CACTGCCAGCAATGGCTCTGCGG - Intergenic
1183697559 22:39431776-39431798 CTCTTCCAAGAATGCCTCTGTGG + Exonic
949883202 3:8677069-8677091 CTCTTCCCCCTGTGGCTCTTAGG + Intronic
949883477 3:8678533-8678555 CTCTTCCCTCCATGGCTCTTAGG + Intronic
949883636 3:8679015-8679037 CTCTTCCCCCCCTGGCTCTTAGG + Intronic
949883768 3:8679409-8679431 CTCTTCCCCCCCTGGCTCTTAGG + Intronic
949883824 3:8679568-8679590 CTCTTCCCCCCCTGGCTCTTGGG + Intronic
949883982 3:8680315-8680337 CTCTTCCCTCTCTGGCTCTTAGG + Intronic
949884075 3:8680969-8680991 CTCTTCCCTCCCTGGCTCTTAGG + Intronic
949884101 3:8681048-8681070 CTCTTCCCCCGCTGGCTCTTAGG + Intronic
949884231 3:8681442-8681464 CTCTTCCCCCACTGGCTCTTAGG + Intronic
949884341 3:8681754-8681776 CTCTTCCCCCTCTGGCTCTTAGG + Intronic
955411750 3:58660008-58660030 CTCTACCAGCAATGCTGCTTGGG + Intronic
957079497 3:75623956-75623978 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
958735250 3:98001624-98001646 CTCTTGCAGGAACAGCTCTTCGG + Exonic
959264355 3:104118729-104118751 CTCTCAGAGCAATGCCTCTTAGG - Intergenic
959621585 3:108403800-108403822 TTCTTCCAGCCCTAGCTCTTTGG + Intronic
961041661 3:123682595-123682617 CTCTGCCAGCAATGGCATTCCGG - Intronic
965845377 3:172954741-172954763 TTATTCCAGCAATGGCTTTGGGG + Intronic
969731192 4:8959103-8959125 CTCTTCCCACCCTGGCTCTTAGG + Intergenic
969731239 4:8959263-8959285 CTCTTCCCCCACTGGCTCTTAGG + Intergenic
969788168 4:9474421-9474443 CTCTTGCCCCCATGGCTCTTGGG + Intergenic
969790478 4:9491054-9491076 CTCTTCCCCCTCTGGCTCTTAGG + Intergenic
969790820 4:9493290-9493312 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
969790848 4:9493370-9493392 CTCTTCCACTCCTGGCTCTTAGG + Intergenic
969790870 4:9493450-9493472 CTCTTCCCCCACTGGCTCTTAGG + Intergenic
969878949 4:10157232-10157254 CTGTTCTAGAAATGGCTCCTGGG + Intergenic
971435616 4:26619770-26619792 CTATTCCAGCAATGTTTCTATGG + Intronic
972243851 4:37224097-37224119 CTTTGCAAACAATGGCTCTTGGG + Intergenic
972842745 4:42950607-42950629 TTCTTCCAGCTATGACACTTTGG + Intronic
975683742 4:76899583-76899605 CTTTTCCAGGAATGAATCTTTGG + Intergenic
976351380 4:84063753-84063775 CTCTTGCAGCCCTGGCACTTGGG - Intergenic
977577158 4:98687390-98687412 CTCTTCCAGGGAAGGTTCTTTGG - Intergenic
986258533 5:6122636-6122658 CTCTTCCAGAAAAGCCTCTATGG - Intergenic
987894679 5:23928932-23928954 CTTTTCCATTAATTGCTCTTTGG - Intergenic
991577123 5:68116079-68116101 CCCTGCCACCACTGGCTCTTTGG - Intergenic
993861732 5:93144874-93144896 GTCTTCCACCAATGGACCTTGGG - Intergenic
996460160 5:123732534-123732556 CTCTTCCAGCCATGGCTGAAAGG + Intergenic
998141959 5:139705034-139705056 CTCCTCCAGGAAGGGCTCTCAGG + Intergenic
1000502225 5:162066525-162066547 GTCTTCCAGGAATGGAACTTGGG - Intergenic
1001443136 5:171761477-171761499 CTCATCTAGCAATGGCTCTAAGG - Intergenic
1002637803 5:180616800-180616822 CTCACCCTGCAATGGCTCTGTGG - Intronic
1004917090 6:20342110-20342132 CTCTTTCTGCAAAGGCTGTTTGG - Intergenic
1007174241 6:39885342-39885364 CTCTTTGAGCACTGGCTCCTGGG + Intronic
1007271455 6:40640656-40640678 CTCTTGCAGCAACAGCTCTGTGG + Intergenic
1008046924 6:46860565-46860587 TTCTGCCAGCTATGGCTTTTAGG - Intronic
1008219609 6:48839452-48839474 CACTTCTAGACATGGCTCTTAGG - Intergenic
1008276087 6:49545929-49545951 GTCTTTCAGCAAAGACTCTTAGG - Intergenic
1010531275 6:76970320-76970342 TTCTTGCTGCAATTGCTCTTGGG - Intergenic
1016520916 6:144945537-144945559 ATCTTCCAGCAATGCATGTTTGG - Intergenic
1016543665 6:145195877-145195899 GGGTTCCAGGAATGGCTCTTAGG + Intergenic
1020309990 7:6859935-6859957 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1020686448 7:11301764-11301786 CTCATCCAAGAAAGGCTCTTTGG - Intergenic
1024756429 7:52538577-52538599 CTCTTCCAGGGATGAGTCTTTGG + Intergenic
1025237468 7:57244619-57244641 CTCACCCTGCGATGGCTCTTGGG - Intergenic
1026673804 7:72412624-72412646 CTCCTCCAGCAGTGGCCCCTGGG - Intronic
1027866592 7:83655815-83655837 CTCTTCCATGGATGGCTATTTGG - Intergenic
1033000958 7:137504076-137504098 CTCTTTCTGCTTTGGCTCTTAGG - Intronic
1033428951 7:141271123-141271145 CTACCCCAGCAATGGCTCCTGGG + Intronic
1034303302 7:150034022-150034044 CTCTTCCCCCCCTGGCTCTTGGG - Intergenic
1034303479 7:150034845-150034867 CTGTTCCCCCACTGGCTCTTAGG - Intergenic
1034303811 7:150035944-150035966 CTCTTCCCGCCCTGGCTCTGAGG - Intergenic
1034304103 7:150037096-150037118 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1034304386 7:150038028-150038050 CTCTTCCCCCCATGGCTCTTGGG - Intergenic
1034305561 7:150042528-150042550 CTCTTCCCCCCCTGGCTCTTGGG - Intergenic
1034801557 7:154058992-154059014 CTGTTCCCCCACTGGCTCTTAGG + Intronic
1034801586 7:154059072-154059094 CTCTTCCCCCTCTGGCTCTTAGG + Intronic
1034801640 7:154059234-154059256 CTGTTCCCCCACTGGCTCTTAGG + Intronic
1034801818 7:154060056-154060078 CTCTTCCCCCCCTGGCTCTTGGG + Intronic
1034801895 7:154060292-154060314 CTCTTCCCCCCCTGGCTCTTAGG + Intronic
1034802038 7:154060760-154060782 CTCTTCCCCCCCTGGCTCTTAGG + Intronic
1034802065 7:154060840-154060862 CTGTTCCCCCACTGGCTCTTAGG + Intronic
1034802238 7:154061663-154061685 CTCTTCCCCCCCTGGCTCTTGGG + Intronic
1034802746 7:154063243-154063265 CTATTCCCCCACTGGCTCTTAGG + Intronic
1035554593 8:556786-556808 CTCTGTAAGCATTGGCTCTTTGG + Intergenic
1039298958 8:36188755-36188777 CACTTTCATCAATGGCTCCTTGG + Intergenic
1039661645 8:39474419-39474441 CACTTTCAGGGATGGCTCTTGGG + Intergenic
1041205248 8:55493004-55493026 CTATGCCAACAATGACTCTTTGG + Intronic
1042098447 8:65245850-65245872 CTCATCCAGAAATGGCTAATTGG + Intergenic
1044321992 8:90812707-90812729 CGCTTCCAGGAATGGGTCTCGGG + Intronic
1045393152 8:101735002-101735024 CCCTTCCTTCAATGGCTTTTTGG - Intronic
1048746617 8:137621448-137621470 GTTTTCCATCAATGGCTCTTTGG + Intergenic
1048799203 8:138180857-138180879 TACTTCCAGCACTGGCTCTGGGG + Intronic
1053203608 9:36168862-36168884 CTCTTCCTGCCAAGGCTCCTGGG - Intergenic
1053736126 9:41104173-41104195 CTCTTCCCCCACTGGCTCTTGGG + Intergenic
1053736264 9:41104793-41104815 CTCTTCCCCCACTGGCTCTTAGG + Intergenic
1053736528 9:41106565-41106587 CTCTTCCTCCCCTGGCTCTTAGG + Intergenic
1053736626 9:41106883-41106905 CTCTTCCCCCCGTGGCTCTTAGG + Intergenic
1053736963 9:41108206-41108228 CTCTTCCCCTACTGGCTCTTAGG + Intergenic
1053737154 9:41108765-41108787 CTCTTCCCTCCCTGGCTCTTGGG + Intergenic
1053737287 9:41109156-41109178 CTCTTCCCCCCCTGGCTCTTAGG + Intergenic
1054691062 9:68322163-68322185 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1054691086 9:68322234-68322256 CTCTTCCCCCACTAGCTCTTAGG - Intergenic
1054691194 9:68322552-68322574 CTCTTCCCTCCCTGGCTCTTGGG - Intergenic
1054691411 9:68323191-68323213 CTCTTCCCCTACTGGCTCTTAGG - Intergenic
1054691636 9:68324176-68324198 CTCTTCCCCCCCTGGCTCTTGGG - Intergenic
1054691701 9:68324359-68324381 CTCTTCCCCCCCTGGCTCTTGGG - Intergenic
1054692109 9:68326607-68326629 CTCTTCCCCCACTGGCTCTTAGG - Intergenic
1054692248 9:68327227-68327249 CTCTTCCCCCACTGGCTCTTGGG - Intergenic
1055925946 9:81509880-81509902 CTCTTCTTGCATTGGCTCTAAGG - Intergenic
1058539358 9:105995496-105995518 GTCTCCCAGCACTGGCTCATGGG + Intergenic
1061040534 9:128138728-128138750 CTCTTCCCCCCCTGGCTCTTAGG - Intergenic
1061041021 9:128140498-128140520 CTCTTCCCCCGCTGGCTCTTAGG - Intergenic
1062142176 9:134965597-134965619 CTCGTGCATCACTGGCTCTTGGG + Intergenic
1189697731 X:43682450-43682472 TTCTTCCAGCTATGGTTATTAGG - Intronic
1193439530 X:81521753-81521775 TTCTGCCAACAATGTCTCTTGGG - Intergenic
1194723690 X:97370033-97370055 CTCTTTCACTCATGGCTCTTAGG - Intronic
1195251661 X:103053558-103053580 CTCAACCAGTAATGGCCCTTAGG - Intergenic
1196891556 X:120295477-120295499 CTCAGACAGCAATGTCTCTTGGG + Intronic
1197261848 X:124328218-124328240 TTCTTCTATCAATGGCTTTTGGG + Intronic
1199150163 X:144422728-144422750 CTTCTCCAGCTATGTCTCTTTGG - Intergenic
1200228772 X:154433728-154433750 CCCTTCCAGCAGGGGCTCTGGGG + Intronic
1202048128 Y:20754353-20754375 CTCTTAGAGCTTTGGCTCTTAGG - Intergenic
1202098718 Y:21282278-21282300 CTCTGCCAACAATAGCTCTTTGG - Intergenic