ID: 1166808334

View in Genome Browser
Species Human (GRCh38)
Location 19:45499987-45500009
Sequence CAGAAGGCCTAGGGGCCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 285}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166808334_1166808344 -5 Left 1166808334 19:45499987-45500009 CCCTGGGGCCCCTAGGCCTTCTG 0: 1
1: 0
2: 2
3: 17
4: 285
Right 1166808344 19:45500005-45500027 TTCTGAGGAGGCGATCAGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 157
1166808334_1166808346 19 Left 1166808334 19:45499987-45500009 CCCTGGGGCCCCTAGGCCTTCTG 0: 1
1: 0
2: 2
3: 17
4: 285
Right 1166808346 19:45500029-45500051 GCTAGCACTGGACGCAGCCCTGG 0: 1
1: 0
2: 9
3: 85
4: 451
1166808334_1166808343 -6 Left 1166808334 19:45499987-45500009 CCCTGGGGCCCCTAGGCCTTCTG 0: 1
1: 0
2: 2
3: 17
4: 285
Right 1166808343 19:45500004-45500026 CTTCTGAGGAGGCGATCAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 144
1166808334_1166808347 20 Left 1166808334 19:45499987-45500009 CCCTGGGGCCCCTAGGCCTTCTG 0: 1
1: 0
2: 2
3: 17
4: 285
Right 1166808347 19:45500030-45500052 CTAGCACTGGACGCAGCCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 140
1166808334_1166808341 -9 Left 1166808334 19:45499987-45500009 CCCTGGGGCCCCTAGGCCTTCTG 0: 1
1: 0
2: 2
3: 17
4: 285
Right 1166808341 19:45500001-45500023 GGCCTTCTGAGGAGGCGATCAGG 0: 1
1: 0
2: 0
3: 9
4: 88
1166808334_1166808345 7 Left 1166808334 19:45499987-45500009 CCCTGGGGCCCCTAGGCCTTCTG 0: 1
1: 0
2: 2
3: 17
4: 285
Right 1166808345 19:45500017-45500039 GATCAGGAGGGAGCTAGCACTGG 0: 1
1: 0
2: 4
3: 16
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166808334 Original CRISPR CAGAAGGCCTAGGGGCCCCA GGG (reversed) Exonic
900154771 1:1199505-1199527 CGGAGGGCACAGGGGCCCCAGGG - Intergenic
900174302 1:1285042-1285064 CAGATGGCCTTGGGGACGCAGGG + Intronic
900212077 1:1461050-1461072 CAGGAGCCCTGTGGGCCCCAAGG + Intronic
900523372 1:3116766-3116788 CAGCAGGCCTAGCTGCTCCATGG + Intronic
900652438 1:3736459-3736481 CAGAAGGCCTGGGCCCCACAGGG - Intergenic
900742213 1:4337550-4337572 CAGAAGTCCTGGTGTCCCCAGGG - Intergenic
900877906 1:5358907-5358929 CAGAAGGCAAAGGGGGACCAGGG - Intergenic
901152428 1:7112767-7112789 CAGAGGGCCTGGGAGACCCAGGG - Intronic
901770940 1:11530091-11530113 CAGAACCCCTATGGGCCCCTGGG + Intronic
902613597 1:17611198-17611220 CAGAAGGCCCAGGGGCTTTATGG + Intronic
902686829 1:18082855-18082877 GACCAGGCCTGGGGGCCCCATGG + Intergenic
903778763 1:25808924-25808946 CCGACGGCCCAGGGGCCCCATGG - Intronic
904285198 1:29449526-29449548 CAGGAGGACTTGGGGCCCAAAGG + Intergenic
906431745 1:45760893-45760915 CATAAGGCCTAGGGGCCTGTCGG + Intergenic
906676960 1:47700313-47700335 CACAAGGCCTAGAGGCCACTAGG + Intergenic
910141494 1:84031677-84031699 CAGAAGGGGTAGGGCCCTCATGG - Intergenic
911515713 1:98866120-98866142 CAAAAGGGCTACAGGCCCCATGG + Intergenic
912315550 1:108664661-108664683 AAGAAGACTAAGGGGCCCCACGG + Intergenic
913255022 1:116945162-116945184 CAGAAGGCCATGGGGCTCCCTGG - Intronic
916108712 1:161448114-161448136 CAGGAGGCCCAGGGGGCCAAGGG + Intergenic
916110300 1:161455495-161455517 CAGGAGGCCCAGGGGGCCAAGGG + Intergenic
916111885 1:161462905-161462927 CAGGAGGCCCAGGGGGCCAAGGG + Intergenic
916113472 1:161470286-161470308 CAGGAGGCCCAGGGGGCCAAGGG + Intergenic
917619916 1:176785414-176785436 CAGAAGTCCTGGGAGGCCCATGG + Intronic
918407149 1:184222553-184222575 CAGAAGAACTAGGGAACCCAGGG - Intergenic
919704479 1:200663231-200663253 CAGAACACCAAGGGGCCCCGAGG + Intronic
920366572 1:205451058-205451080 CAGCAGCCCAAGGGGCCCAAGGG + Intronic
920560064 1:206932514-206932536 CACCAGGCCCAGGGGCACCAGGG + Exonic
923245501 1:232127364-232127386 CAGAAGGCATGGAGGCCACAAGG - Intergenic
1065754581 10:28919428-28919450 CCGAAGGCCAAGGGTCCGCATGG + Intergenic
1066047994 10:31611236-31611258 CAGGAGGCTGAGGAGCCCCAGGG + Intergenic
1067061381 10:43079683-43079705 CAGAAGGCCCCGGGGCCCAGGGG - Intronic
1067751623 10:48975547-48975569 CAGAAAACCTAAGGGGCCCAGGG + Intronic
1069267077 10:66473398-66473420 CAGAAGGCAAAGGGGCAGCAAGG - Intronic
1073116257 10:101093536-101093558 GAGAAGCCCCAGGGGCTCCATGG - Intronic
1073510267 10:104038463-104038485 CCGGAGGCCCAGGGGGCCCAGGG + Exonic
1075001610 10:118802723-118802745 CACAAGGATTAGGGGCCCCTAGG - Intergenic
1075030556 10:119021906-119021928 CAGAAGGCAGGTGGGCCCCAGGG - Intergenic
1075439438 10:122467689-122467711 CCAAAGGCCTTGGAGCCCCAGGG - Intronic
1076137529 10:128055374-128055396 CAGAGGGGATAGGGGCCCCGCGG + Intronic
1076142000 10:128086722-128086744 CAGATGGCCTGAGGGCCCCCAGG - Intergenic
1076393313 10:130120140-130120162 CAGAAGGCCAAGGGGCAGCGGGG + Intergenic
1076679202 10:132163040-132163062 CAGAAGGACCAGGGGCCCCACGG - Intronic
1076686418 10:132200287-132200309 CAGCAGTTCTCGGGGCCCCAGGG + Intronic
1076711736 10:132339450-132339472 CAGAGTCCCTAGGAGCCCCATGG - Intronic
1076742418 10:132493302-132493324 CAGCAGGCCCTGGGGGCCCATGG - Intergenic
1077221725 11:1420920-1420942 CAGAGGGCCGAGGGGGCCCTGGG - Intronic
1077461683 11:2714007-2714029 CTGCAGGCCTGGGTGCCCCAAGG - Intronic
1081347702 11:42010715-42010737 CGGAAGGAGTAGGGGCCCTAAGG - Intergenic
1083049695 11:59766087-59766109 CAGAAAGCCCAGGAGCCCCCAGG - Intronic
1083430414 11:62611369-62611391 CTGAAGCCCCAGAGGCCCCAAGG + Intronic
1084289357 11:68151906-68151928 CAGCAGGGCTGGGGGCCCTAGGG - Intergenic
1085331268 11:75653333-75653355 CAAAAAGCCCAGGGGCCCCAAGG - Intronic
1085397759 11:76215620-76215642 GAGCAGGCCTGGGGGCACCACGG + Intergenic
1085469055 11:76745215-76745237 CAGGAGGCCCAGGAGGCCCAGGG - Intergenic
1085530192 11:77187870-77187892 CAGGAGGCCTAGTGACCCCTGGG - Intronic
1088358739 11:108969465-108969487 CAGATGGCACAGGGTCCCCAGGG + Intergenic
1089643815 11:119864966-119864988 CACATGGCCCAGGGGCACCAGGG + Intergenic
1089785395 11:120903677-120903699 CAGCAGGGCTGGGGGTCCCAGGG - Intronic
1091552971 12:1550736-1550758 CAAAGGGGCTATGGGCCCCACGG - Intronic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1092531727 12:9350644-9350666 CAGCAGGCCCATGGGCCCCAGGG - Intergenic
1094502594 12:31034457-31034479 CAGCAGGCCCATGGGCTCCAGGG - Intergenic
1094847930 12:34369549-34369571 CACAAGGCCCAGGGGACCCTGGG - Intergenic
1094849200 12:34374813-34374835 CACAAGGCCCAGGGGACCCTTGG - Intergenic
1095981884 12:47978722-47978744 CAGAAGGACCAGGGGGACCAGGG + Exonic
1096237509 12:49939769-49939791 CTGGAGTCCTAGGGGACCCAGGG + Intergenic
1096669504 12:53190208-53190230 CAGAGGGCCCGGGAGCCCCACGG + Exonic
1098063545 12:66587803-66587825 CAGAAGGCAGAGGGGTTCCAGGG + Intronic
1098613029 12:72485482-72485504 CAGGAGGCCTGAGGTCCCCAGGG - Intronic
1101331647 12:103762190-103762212 CAGAATGCCTCGGGCCACCAAGG + Intronic
1102572324 12:113834452-113834474 CAGAAGCCCTAGGGGCTGCAAGG + Intronic
1102959775 12:117085044-117085066 CAGCTGGCCAAGGGGCACCAGGG + Intronic
1103011628 12:117462655-117462677 CAGCAGTCCTAGGAGCCTCACGG + Exonic
1105449771 13:20489118-20489140 CAGAATCCCTAGTGGCCTCACGG + Intronic
1108035991 13:46291114-46291136 CACATTGCCTAGGGGCCACACGG - Intergenic
1110613362 13:77513951-77513973 CAGAAGGCCTGAGAGCCCCCAGG + Intergenic
1111553806 13:89852577-89852599 CAGAGTACCTAGGTGCCCCAGGG + Intergenic
1112186540 13:97133388-97133410 CAGAAGGCCGATGGAACCCAGGG - Intergenic
1113068310 13:106393649-106393671 CCGAAGGCCTGAGGGCCCCTGGG - Intergenic
1114265431 14:21070420-21070442 GCGAAGGCCGAGGGGACCCAGGG - Intronic
1114788183 14:25625168-25625190 CAGAAGGCAAAGGGGAACCAAGG + Intergenic
1115754518 14:36518690-36518712 CAGAAGACCTCGGGGAGCCAAGG - Intronic
1119665807 14:76484297-76484319 CAGAATGCCCAGGGGCCACCAGG - Intronic
1122251290 14:100441593-100441615 CAGATGGGCTGGGGGCCACATGG + Intronic
1122505167 14:102227414-102227436 CAGAGGGCCTGGGAGTCCCAGGG - Intronic
1123038889 14:105482443-105482465 CACAAGGCCCTGGTGCCCCATGG + Intergenic
1123067057 14:105624104-105624126 GAGAAGCCCTAGGAGCCCCTGGG - Intergenic
1123076041 14:105667873-105667895 GAGAAGCCCTAGGAGCCCCTGGG - Intergenic
1123090741 14:105741101-105741123 GAGAAGCCCTAGGAGCCCCTGGG - Intergenic
1125300863 15:38252572-38252594 GAGCAGGGCTAGGGGCCCCGCGG - Exonic
1125501248 15:40241411-40241433 CACCAGGCCTGGGGGCCACACGG - Intronic
1125687929 15:41574680-41574702 CTGAAGGCCTAGGGAGCCCTTGG - Intronic
1128212936 15:65915026-65915048 CTGAAGGCCGAGGAGCCCAAAGG - Intronic
1128465586 15:67908186-67908208 CAGAATTCCTAAGGGCCTCAGGG + Intergenic
1128696132 15:69764211-69764233 GAGAAGCCCCAGGGGCACCAGGG - Intergenic
1129704021 15:77784283-77784305 CAGAAGGCCATGGGGCTCTAAGG + Intronic
1130772560 15:86939416-86939438 CGGAAGGCCTGAGGGCCCCTGGG - Intronic
1131842245 15:96449852-96449874 CAGAAGCCATAGTGGCTCCAAGG - Intergenic
1132381089 15:101367148-101367170 CAGAAGGCCCAGGGGCTCAAGGG - Intronic
1132467127 16:82496-82518 CAGTAGGCCCAGCTGCCCCACGG - Intronic
1132619257 16:856592-856614 GTCAAGGCCTAGGGGGCCCAGGG + Intronic
1133934378 16:10256874-10256896 CAGGATGCCGAGGGGCCCCAGGG + Intergenic
1134021470 16:10924116-10924138 GAGAAGGCCTCGGGGCTCCTGGG - Exonic
1135024610 16:18989520-18989542 CAGAAGGTCTAGGTGGCCCCAGG - Intronic
1135315462 16:21441037-21441059 CAGAAGGTCTAGGTGGCCCCAGG + Intronic
1135368388 16:21873305-21873327 CAGAAGGTCTAGGTGGCCCCAGG + Intronic
1135443429 16:22497844-22497866 CAGAAGGTCTAGGTGGCCCCAGG - Intronic
1135449227 16:22543309-22543331 CAGAAGGTCTAGGTGGCCCCAGG - Intergenic
1135625966 16:23995248-23995270 CAGAAGCTCTTGGGGCCCCTTGG - Intronic
1136139504 16:28279652-28279674 GACAAAGCCCAGGGGCCCCAGGG + Intergenic
1136312132 16:29419696-29419718 CAGAAGGTCTAGGTGGCCCCAGG + Intergenic
1136325571 16:29521493-29521515 CAGAAGGTCTAGGTGGCCCCAGG + Intergenic
1136365531 16:29807471-29807493 CAGGAGGCTCAGGGGCACCATGG - Exonic
1136440260 16:30261475-30261497 CAGAAGGTCTAGGTGGCCCCAGG + Intergenic
1137580840 16:49632565-49632587 AGGAAGGCCTGGGGGCCCCCAGG + Intronic
1139886757 16:70213757-70213779 CAGAAGGTCTAGGTGGCCCCAGG + Intergenic
1139949495 16:70662249-70662271 CAGAGGGCATCGTGGCCCCAGGG - Exonic
1140230690 16:73114972-73114994 TAGAAGGGCCTGGGGCCCCAGGG - Intergenic
1141171982 16:81697302-81697324 CAGAAGGCCTGTGGGACCCCAGG - Intronic
1141451666 16:84107650-84107672 CAGAGGGACTGGGGTCCCCAAGG + Intronic
1141833540 16:86523282-86523304 CAGAAGGCCTAAGGGACTTAGGG - Intergenic
1142713799 17:1737293-1737315 GGGAAGGCCTTGGGGCCCAAGGG + Intronic
1143151424 17:4809417-4809439 GAGGAGGGCCAGGGGCCCCAGGG + Intronic
1143482553 17:7236071-7236093 CAGGGGGCCTAGGAGCCTCAGGG + Exonic
1144160233 17:12550872-12550894 CAGAAGGCCTAGCTGCCTAATGG + Intergenic
1144766609 17:17736419-17736441 CAGATGGCCGAGAGGTCCCAAGG + Intronic
1145217105 17:21060879-21060901 CAGGAGGCATACAGGCCCCAGGG - Intergenic
1145866276 17:28243892-28243914 CAGAAGGCGTAGGGGAAGCAAGG - Intergenic
1148359027 17:46996575-46996597 AACCAGGCCTAGGGGCCCCTGGG - Intronic
1148794840 17:50191988-50192010 CAGAGGGGCCAGGGGCGCCAAGG + Exonic
1148795854 17:50196313-50196335 CAGCAGGGCCAGGGGCTCCAGGG + Exonic
1148809903 17:50283746-50283768 CAGAAGGGCTGGGGGCCTCCAGG - Intergenic
1148842426 17:50507866-50507888 CAGAATGCCTCAGGGCTCCAGGG + Intergenic
1148868351 17:50641033-50641055 CAACAGGCCTGGGGCCCCCAGGG + Intronic
1150155974 17:62853448-62853470 CAGAAGGCAAAGGGGACGCAAGG + Intergenic
1150787595 17:68175549-68175571 AACCAGGCCTAGGGGCCCCTGGG + Intergenic
1151471663 17:74322157-74322179 CAGAAGGCAATGGGGCACCATGG + Intergenic
1151527923 17:74683712-74683734 CAGAAGGCAGAGGTGCCCCAGGG - Intronic
1151967550 17:77439358-77439380 CTGCAGCCCTGGGGGCCCCAGGG + Intronic
1152124350 17:78437560-78437582 CAGTGGTCCTCGGGGCCCCAAGG + Intronic
1152206341 17:78976554-78976576 CAGCAGGCCTAGGGACCCCTGGG + Intronic
1152218634 17:79048847-79048869 CTGCAGGCCTGGGGGACCCAGGG - Exonic
1152228497 17:79103448-79103470 CAGGAGGGGTATGGGCCCCAGGG + Intronic
1152240104 17:79156527-79156549 GGGCAGGCCTAGGGTCCCCATGG + Intronic
1152621810 17:81368626-81368648 GAGAAGGCCTGGGGGCGCGAGGG - Intergenic
1152677417 17:81648613-81648635 CAGAAGGGGTGGCGGCCCCAGGG - Exonic
1154464360 18:14629709-14629731 CAGAAGGCCTAGGCTCCCAGTGG - Intergenic
1155522748 18:26685556-26685578 GGGAAGGCCAAGGGGCCACAGGG + Intergenic
1156987202 18:43362091-43362113 CCGAAGGCCCAAGGGCCCCAGGG + Intergenic
1158589665 18:58768769-58768791 TAGAAGGCCTGGGGGCCCTCAGG + Intergenic
1160820043 19:1053685-1053707 GGGAAGGCCTGGGGGACCCATGG + Intronic
1160904600 19:1446286-1446308 CAGGAGCCCCAGGAGCCCCATGG - Intronic
1162322274 19:9977382-9977404 CAGAAGGCCCAGCAGCTCCAGGG + Exonic
1162399304 19:10435198-10435220 GGGAAGGCCTAGGGGCCACGTGG + Intronic
1163034842 19:14564485-14564507 AGGCAGGCCTAGGGGCCCGACGG - Intronic
1163326676 19:16608021-16608043 AAGCAGGCCAAGGGGCACCAGGG + Intronic
1163475120 19:17521317-17521339 CAGCAGGCCTGGGGGCGCCCTGG + Intergenic
1164800099 19:31068987-31069009 GAGAAGGCCCAGGGGGCCTAGGG - Intergenic
1165291176 19:34887596-34887618 CAGAAAGCCTAGCAGCCCCCTGG + Intergenic
1165473126 19:36014768-36014790 CTGAAGGCCCAGGGGGTCCAGGG - Exonic
1165505840 19:36228653-36228675 CAGAAGGCCAGGAGACCCCAGGG + Intronic
1165987349 19:39781662-39781684 CAGAAGGCGAAGGGGAGCCAAGG - Intronic
1166281693 19:41798376-41798398 CAGGATCCCTAGGGTCCCCAGGG - Intronic
1166808334 19:45499987-45500009 CAGAAGGCCTAGGGGCCCCAGGG - Exonic
1166906613 19:46114706-46114728 CAGAAGGCAAAGGGGAACCAAGG - Intergenic
1167348404 19:48960996-48961018 CAGAAGGCCCAGGGTCCCAGAGG - Exonic
1168594523 19:57664520-57664542 CTGCAGGCCGAGGGGCCCCTGGG + Intergenic
925815066 2:7739387-7739409 CAGAAGGCAAAGGGGAACCAAGG - Intergenic
927517478 2:23680688-23680710 AAGATGGCCTAGAGACCCCAGGG - Intronic
927517486 2:23680712-23680734 AAGATGGCCTAGAGACCCCAGGG - Intronic
927517494 2:23680736-23680758 AAGATGGCCTAGAGACCCCAGGG - Intronic
927671565 2:25072792-25072814 CAGCAGTCCTGTGGGCCCCAAGG - Intronic
927795462 2:26044517-26044539 CAGAAGGCCAAAAGGCCACATGG + Intronic
927883234 2:26703537-26703559 CAGAGGGCCTCAGGGCCCCAAGG - Intronic
928125733 2:28614516-28614538 AACAAGGCCTAGGGGCCCACAGG - Intronic
929444283 2:41990674-41990696 CAGAAGGTGTAAGTGCCCCAAGG - Intergenic
930866319 2:56125626-56125648 CAGAAGCCCCAGGGGTTCCAGGG + Intergenic
931665823 2:64609162-64609184 CAGAAAGCCGAGGGGGCGCAGGG + Intergenic
931977647 2:67660775-67660797 CTGAGGATCTAGGGGCCCCAAGG - Intergenic
932423410 2:71614279-71614301 CAGAAGTTCTGGGAGCCCCAGGG - Intronic
932817695 2:74874885-74874907 CAGGAGGCCCTGGGACCCCAGGG - Intronic
934735693 2:96688814-96688836 CAGGAGGGCTAGGCTCCCCAGGG - Intergenic
935151756 2:100443254-100443276 CAGAAGGCAAAGGGGAACCAAGG - Intergenic
935595245 2:104872967-104872989 CTGACGCCCTAGGGTCCCCAAGG + Intergenic
936918215 2:117661578-117661600 CAGAGGGCCTGGGGACCCGAGGG + Intergenic
939617861 2:144380551-144380573 CAGGAGGCCTCGGGCTCCCACGG + Intergenic
940584123 2:155622542-155622564 TAGAAGGCCTAGGAATCCCAAGG + Intergenic
1171425233 20:25044720-25044742 CTGTAGGCCTAGTGGCCCCAAGG - Intronic
1172385409 20:34530698-34530720 CAGAGGGCTTAAAGGCCCCATGG - Intronic
1174309010 20:49635906-49635928 CTGAAGGCCAAGAGGCTCCAAGG + Exonic
1174404535 20:50294812-50294834 CAGAAGGCCTTGGGGCCAAGGGG + Intergenic
1175240204 20:57541887-57541909 CAGAAGGCCTGGGGGTCACCTGG + Intergenic
1175887501 20:62300763-62300785 CAGAAGCCCCAGGGTCCGCAGGG - Intergenic
1176810178 21:13528680-13528702 CAGAAGGCCTAGGCTCCCAGTGG + Intergenic
1176861324 21:14012972-14012994 CTGGAGGCCTAGGGGCCCTCAGG + Intergenic
1176861345 21:14013061-14013083 CTGGAGGCCTAGGGGCCCTCAGG + Intergenic
1177724625 21:24951047-24951069 CAAAAGGCCCAAGGGCCCCCAGG + Intergenic
1178404015 21:32310141-32310163 CAGAAGGCCTGTGCCCCCCAGGG - Intronic
1179572308 21:42284913-42284935 CAGAAGGCCATGGGTACCCAGGG - Intronic
1179980131 21:44891372-44891394 CTGATGGCCTTGGGTCCCCAAGG + Intronic
1180085267 21:45505386-45505408 CAGGGGGCCCAGGGGGCCCAGGG - Exonic
1180185757 21:46138476-46138498 CAGGAGGCCTGGGGTCCCCCGGG + Intronic
1180914094 22:19473290-19473312 CAGAGGGACTGGGAGCCCCAGGG - Intronic
1182108478 22:27705902-27705924 CAGAAGGCCAAGGGGAAGCAAGG + Intergenic
1183028412 22:35083901-35083923 CAGCCGGCCAAGAGGCCCCAGGG + Intronic
1183305317 22:37079965-37079987 CAGCTGGCCTAGGGAACCCATGG + Intronic
950108122 3:10401182-10401204 CAGAATGCCTAGAGCTCCCAGGG + Intronic
951976279 3:28513517-28513539 CATAAAGCCTAGGGACTCCAAGG - Intronic
952235470 3:31474719-31474741 CAGAAGGCAAAGGAGCCTCACGG - Intergenic
952671474 3:35974391-35974413 CAAAAGGGCTATTGGCCCCATGG + Intergenic
953032076 3:39185823-39185845 CAGATGGCCTGGGGGCCACCAGG - Exonic
953072388 3:39534231-39534253 CAGAAGGCAAAGGGGAGCCAGGG + Intergenic
954288805 3:49638160-49638182 GAGAGGGCCTAGGAGCCACAGGG + Intronic
959814856 3:110663073-110663095 CAGAAGGCCAAGGGGAAGCAAGG - Intergenic
961236610 3:125373580-125373602 CAGAAGGTCTAGGGGAACCTAGG - Intronic
961290219 3:125840763-125840785 CTGGAGGGCTAGGGGCCACATGG - Intergenic
961380388 3:126492802-126492824 CAGATGGCTCAGGGGCTCCAAGG - Intronic
961536406 3:127573455-127573477 CAGCAGGCCCAGAGTCCCCAGGG - Exonic
962864397 3:139435244-139435266 CAGAAGGCTGAGCTGCCCCAGGG + Intergenic
966715529 3:183010163-183010185 CAGAAGGCATGGTGTCCCCAGGG + Intergenic
968460806 4:723861-723883 CAGAAGGCCTGTGGTCTCCATGG + Intronic
968540377 4:1165311-1165333 CAGAAGTCTCTGGGGCCCCAGGG - Intergenic
968554854 4:1241750-1241772 GAGTAGGCCTCGGGGCCACAGGG - Intronic
970872667 4:20834220-20834242 CAGAAGCCCTAGAGATCCCATGG + Intronic
971591470 4:28474216-28474238 CAGAAGGCAAAGGGGACGCAAGG - Intergenic
972986763 4:44774377-44774399 CTGAAGGCCAAAGGGCCCCCAGG + Intergenic
974471859 4:62329373-62329395 CAGAAGGACTAGGGAACCAAAGG + Intergenic
974716061 4:65669843-65669865 CAGAAGGCGTAGGACCCCAAGGG - Exonic
976878676 4:89890456-89890478 CAGAATGGCTAGGTGACCCAAGG - Intronic
978044794 4:104113267-104113289 CTGAAGGCCCAAGGGCCCCTGGG + Intergenic
978774275 4:112490354-112490376 CAAAAGGGCTACAGGCCCCATGG + Intergenic
978923657 4:114217083-114217105 CACAAGAGCTTGGGGCCCCAAGG - Intergenic
985619628 5:947403-947425 CAGACAGCCTAGGGAGCCCAAGG - Intergenic
987731063 5:21773536-21773558 CTGAAGGCCCAAGAGCCCCAGGG - Intronic
987967271 5:24893080-24893102 CAAAAGGGCTACAGGCCCCATGG + Intergenic
990003986 5:50923710-50923732 CACGAGGCCTGGGGACCCCATGG - Intergenic
992758629 5:79932393-79932415 CTGAAGTTCTTGGGGCCCCAAGG + Intergenic
993282122 5:85938449-85938471 ATGAAGGCCTAGTTGCCCCACGG + Intergenic
997090881 5:130856109-130856131 CAGAAAGACATGGGGCCCCATGG + Intergenic
998008453 5:138673668-138673690 AACAAGGCCTAAGGTCCCCAAGG - Intronic
999097596 5:148994460-148994482 CATAAGTCCTATGGGCTCCAGGG - Intronic
1001109498 5:168883871-168883893 AAGAAGGTCTAGGGGCCCCCAGG - Intronic
1001144490 5:169171856-169171878 CAGAATGCCTAAGGGGCCTACGG + Intronic
1001236029 5:170030355-170030377 GAGCAGGCACAGGGGCCCCATGG - Intronic
1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG + Intergenic
1006119344 6:31794954-31794976 CAGCAGGCCTGGGGGGCCCAGGG - Exonic
1007490986 6:42221729-42221751 CACACGGCCTAGGGGCCTAATGG + Intergenic
1010672620 6:78704424-78704446 AAGAAGAACTAGGTGCCCCAGGG + Intergenic
1015058728 6:128936092-128936114 CAGAAGGCCAAGGGGAAGCAAGG - Intronic
1018754389 6:166837143-166837165 CAGGAGGCCTCGGAGCCCCCTGG - Intronic
1018905092 6:168071436-168071458 AAGAAGGCCCTGGGGCCACAGGG + Intronic
1018910106 6:168096867-168096889 CAGAAGGCCTAGGGGCACAAAGG + Intergenic
1018993683 6:168694202-168694224 CAGAAGACCGAGGGGTTCCAAGG - Intergenic
1019745793 7:2699877-2699899 CAGAAGGGCAAGGGCCCCCAAGG - Intronic
1021630993 7:22647250-22647272 CAGAACGGCCATGGGCCCCAAGG - Intergenic
1022561938 7:31358564-31358586 CAGCAGGCCTAGGGACCATAGGG + Intergenic
1023626334 7:42118708-42118730 CAGAAGGCCACTGGGCCCCCTGG - Intronic
1023867498 7:44245177-44245199 AAGAAGGCCTGGAGGCTCCAGGG + Intronic
1025070950 7:55898483-55898505 CAGAAGGCCAAGGGGAAGCAAGG + Intronic
1026152249 7:67798067-67798089 CAGAAGGCTTAATGCCCCCAGGG - Intergenic
1034256797 7:149729148-149729170 CAGAAGGCCTGTCAGCCCCACGG - Intronic
1035332844 7:158107556-158107578 CAGAAGTCCTGGTGGCCCCTGGG - Intronic
1035448323 7:158957950-158957972 CGGAAGGCCGAGGGGCCCTCAGG - Intergenic
1037635593 8:20698961-20698983 CAGAAGGCCAAGGGGAAGCAAGG + Intergenic
1038926869 8:32150487-32150509 CAGAAGGGCAAGAGGCCCTAGGG - Intronic
1039669169 8:39577238-39577260 CAGAAAGACAAGGGGCTCCAAGG + Intergenic
1040520830 8:48174611-48174633 CAGAAGACATAGGGGCCTGATGG + Intergenic
1040677300 8:49765846-49765868 CAGAAGGCCTGAGAGCCCCCAGG - Intergenic
1041084897 8:54247704-54247726 CTCCAGGCCTAGGGGTCCCATGG - Intergenic
1044923489 8:97189354-97189376 CAGAAGGCCAAGGGGAAGCAAGG + Intergenic
1045298274 8:100891177-100891199 CTGAAAGCCTAGGGCCACCATGG + Intergenic
1047682475 8:127268296-127268318 CAAAAGGTCTAGGTGCCCCAGGG + Intergenic
1049603313 8:143518057-143518079 CAGAAGGGCTGGGGGCCCTGTGG - Intronic
1050991301 9:12155853-12155875 CAGAATGCCTAGAGGGCCAATGG - Intergenic
1052351007 9:27458222-27458244 CAGAAGGATTAGTGGCACCAAGG - Intronic
1053463513 9:38288660-38288682 CAGATGGCATAGAGGCCTCAGGG - Intergenic
1054769510 9:69070419-69070441 CAGAAGTGCTAGGGGGACCATGG + Intronic
1055787712 9:79888094-79888116 CAGAAGGTCTACAGGGCCCAGGG - Intergenic
1055915510 9:81396360-81396382 CAGAAGGGCTAGGGGGGCCGGGG - Intergenic
1056126855 9:83543294-83543316 CTGAAGGACTTGGGGTCCCATGG + Intergenic
1058349994 9:104010075-104010097 CAGAAGGCCAAGGGGAAGCAAGG - Intergenic
1061294178 9:129667900-129667922 GAGAAGGCCTGGAGGCCTCATGG - Intronic
1061327848 9:129875002-129875024 CAGAAGGCCCATGGGTCCCAGGG - Intronic
1061866773 9:133495344-133495366 AAGAAGCCCCAGGGGCCCCCAGG + Intergenic
1062244923 9:135561391-135561413 CAGAGGGCCTGAGAGCCCCATGG - Intergenic
1062249598 9:135587588-135587610 CAGAGGGCCTGAGAGCCCCATGG - Intergenic
1062281186 9:135752477-135752499 CAGAAGCCCCAGGGGACCCTGGG - Intronic
1062382046 9:136291210-136291232 CAGAGGGCCTGGGGGGCCCAAGG - Exonic
1062539770 9:137036367-137036389 CAGAGTCCCTGGGGGCCCCAGGG + Exonic
1062689163 9:137832544-137832566 GAGAAGGCACAGGGGCCACATGG - Intronic
1062716859 9:138015059-138015081 CAGAACACCTAGGGGTCCCCCGG - Intronic
1186008669 X:5104579-5104601 GAGAAGGCTCAGGGGCCACAGGG + Intergenic
1188004297 X:25006657-25006679 CAGAGGGCCTGGTGGCTCCAGGG + Intronic
1189794644 X:44634701-44634723 CTCAAGGCCAGGGGGCCCCATGG + Intergenic
1189952681 X:46248660-46248682 CAGAAGTCTAAGGGGCCCAAGGG - Intergenic
1191110837 X:56802337-56802359 CAGAGGGCCAAGGGTCCCAAGGG - Intergenic
1191231752 X:58101521-58101543 CAGAATGCCTGGGGTCCCCCAGG - Intergenic
1192195048 X:69022423-69022445 CAGAAGGCCAGGAGTCCCCAGGG + Intergenic
1193250638 X:79287954-79287976 CAGAAAGCTTAGAGGCCACAAGG + Intergenic
1194092608 X:89597821-89597843 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic
1195367255 X:104138447-104138469 CAGATGGGCTGGGAGCCCCACGG + Intronic
1200138787 X:153887101-153887123 AGGAAGGCCTAGGGCCCCGATGG + Intronic
1200445255 Y:3253924-3253946 CAGAAGGCAAAGGGGCAGCAAGG + Intergenic
1201987035 Y:19979904-19979926 CAGAAGGCTGAGGGGACCAATGG + Intergenic