ID: 1166809846

View in Genome Browser
Species Human (GRCh38)
Location 19:45508424-45508446
Sequence CCAGTTAAGCAGATTGTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166809846_1166809853 5 Left 1166809846 19:45508424-45508446 CCGCACACAATCTGCTTAACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1166809853 19:45508452-45508474 CCTAGGACCGAGCGGGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 71
1166809846_1166809855 13 Left 1166809846 19:45508424-45508446 CCGCACACAATCTGCTTAACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1166809855 19:45508460-45508482 CGAGCGGGCGCTCGGAGCAGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
1166809846_1166809856 14 Left 1166809846 19:45508424-45508446 CCGCACACAATCTGCTTAACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1166809856 19:45508461-45508483 GAGCGGGCGCTCGGAGCAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 131
1166809846_1166809849 -3 Left 1166809846 19:45508424-45508446 CCGCACACAATCTGCTTAACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1166809849 19:45508444-45508466 TGGCCGTGCCTAGGACCGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 63
1166809846_1166809850 -2 Left 1166809846 19:45508424-45508446 CCGCACACAATCTGCTTAACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1166809850 19:45508445-45508467 GGCCGTGCCTAGGACCGAGCGGG 0: 1
1: 0
2: 1
3: 6
4: 77
1166809846_1166809857 17 Left 1166809846 19:45508424-45508446 CCGCACACAATCTGCTTAACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1166809857 19:45508464-45508486 CGGGCGCTCGGAGCAGAGGGCGG 0: 1
1: 0
2: 0
3: 23
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166809846 Original CRISPR CCAGTTAAGCAGATTGTGTG CGG (reversed) Intronic
900360403 1:2285796-2285818 CCAGATGAGCAGATCATGTGAGG - Intronic
901171024 1:7257378-7257400 CCAGTTATGCAGTGTGTTTGGGG - Intronic
903375366 1:22862473-22862495 GTAGTTAAGCAGCTTGTCTGGGG + Intronic
906117369 1:43365803-43365825 CCAGGCAAGCAGGATGTGTGGGG - Intronic
906247182 1:44284554-44284576 CCAGTTAAGGAGATTTTGGGGGG - Intronic
908012820 1:59798772-59798794 TCAGTTAAGATGAATGTGTGGGG + Intergenic
913213981 1:116604598-116604620 CTAGTTTTGCAGAGTGTGTGAGG + Intronic
913310824 1:117490733-117490755 CCAGTTAGGCAGATTGTGAAAGG + Intronic
913385483 1:118253938-118253960 TCAGAAAAGCAGATTGTGAGTGG - Intergenic
913514203 1:119589016-119589038 CGAGTGAAGCAGATTGTTTTTGG - Intergenic
918499281 1:185176055-185176077 CCAGGCAGGCAGATTGTCTGAGG + Intronic
920699738 1:208208862-208208884 CCAGTTGAGCAAATTGTGCCTGG - Intronic
1063206705 10:3838842-3838864 CCACTAAAGCAGGTTGTGTTAGG - Intergenic
1063241682 10:4175989-4176011 CGAGTTCAGCAGATGGTGTGAGG + Intergenic
1067808726 10:49410626-49410648 CCAGCCAAGAAGATGGTGTGGGG - Intergenic
1068389155 10:56370753-56370775 ACAGTTAATCAAATTGTGTCAGG - Intergenic
1069898975 10:71696175-71696197 CCAGCAGAGCAGATGGTGTGGGG - Intronic
1072830927 10:98657567-98657589 CAAGGCAAGCAGATTGTTTGAGG - Intronic
1075034186 10:119049225-119049247 CAAGGCAAGCAGATTGTTTGAGG + Intronic
1077192803 11:1262479-1262501 CCAGTGTAGGGGATTGTGTGAGG + Intergenic
1078069587 11:8099547-8099569 CCAACTAAGCATATTGTTTGAGG + Intronic
1078604343 11:12761907-12761929 CCAGTTGAGTAGATTTTGAGGGG + Intronic
1079827151 11:25211684-25211706 CCAGACAATCAGATGGTGTGTGG + Intergenic
1080087287 11:28299591-28299613 TCTGTTAAACAAATTGTGTGAGG - Intronic
1084182307 11:67452915-67452937 CCTGTAAAGTAGATTGTATGAGG - Intronic
1084938312 11:72599072-72599094 CCGGTTAACCAGATTGTCTGAGG - Intronic
1085852279 11:80136093-80136115 CCAGTCAAGAATATTGTGTCTGG - Intergenic
1086003783 11:82012009-82012031 TCAGTTAGGCAGATTGGGTAGGG - Intergenic
1088711976 11:112516461-112516483 CCAATTCAGCAGTTTGGGTGGGG - Intergenic
1090101045 11:123797178-123797200 GCAGTTAAGCAAATTGTGACAGG + Intergenic
1091924231 12:4331372-4331394 TGAGTTAAGCAGATTTGGTGGGG + Intronic
1091929908 12:4387418-4387440 AAAGTTAAGCAGAAAGTGTGAGG - Intergenic
1092471238 12:8783906-8783928 CCAGGTGAGCAGATTGCTTGAGG + Intergenic
1092955548 12:13546228-13546250 CCAGTCAAGAAGATTCTGAGTGG - Exonic
1098645524 12:72895675-72895697 CCAGGTACCCAGAGTGTGTGTGG - Intergenic
1100520566 12:95371347-95371369 CCAGACAAGCAGTTTTTGTGAGG - Intergenic
1101371079 12:104131325-104131347 ACAGTTAAGCAGATGATGTGCGG - Intronic
1105662959 13:22519627-22519649 TCTGTTAAGCAGATAGTGTAAGG - Intergenic
1107411612 13:40163314-40163336 CCAGTTTTGCAGACTGTCTGTGG + Intergenic
1107754905 13:43610365-43610387 TCAGTTGGACAGATTGTGTGGGG - Intronic
1108454894 13:50603536-50603558 GTAGTTAATCAGACTGTGTGTGG - Intronic
1110385467 13:74905828-74905850 CCACACAAGCTGATTGTGTGGGG + Intergenic
1113163484 13:107410663-107410685 ACAATAAAGCAGATTCTGTGAGG + Intronic
1123813619 15:23954688-23954710 TCAGTTAAGTATATTTTGTGAGG + Intergenic
1125681062 15:41530445-41530467 CCAGCTGAGCAGGTTGGGTGGGG - Intronic
1129941249 15:79498573-79498595 CCTGTTCAGGAGAATGTGTGAGG - Intergenic
1135412350 16:22244727-22244749 ACAGGTCAGCAGCTTGTGTGGGG + Exonic
1135979989 16:27139974-27139996 CCAATTAAGGGGATTGTCTGGGG + Intergenic
1138432153 16:56975830-56975852 TCTGGTAAGCAGGTTGTGTGTGG - Intronic
1140061126 16:71570558-71570580 TCAGTCAAGCAGCATGTGTGTGG - Intronic
1143349498 17:6277079-6277101 GAAGTTAAGAAGCTTGTGTGGGG - Intergenic
1144290255 17:13819448-13819470 ACAGTTAAGTATATTGTGGGAGG - Intergenic
1149264323 17:54911164-54911186 ACAGTTAAGAAGATGGTCTGAGG - Intronic
1150545147 17:66149071-66149093 TCAATTAAGATGATTGTGTGAGG + Intronic
1152302768 17:79505116-79505138 CCACTTAAGCAGCTTCTGGGTGG - Intronic
1153582204 18:6584884-6584906 GCAGATAAGAAGAATGTGTGTGG - Intronic
1156011677 18:32503781-32503803 ACAGTTAATCACTTTGTGTGTGG + Intergenic
1158041726 18:53102571-53102593 TCAGCTAAGCAGACTGTCTGAGG - Intronic
1158395097 18:57073095-57073117 CCAGTTAATAAAAGTGTGTGGGG + Intergenic
1158757265 18:60340941-60340963 CCAGAGAGGCATATTGTGTGGGG - Intergenic
1159578138 18:70205127-70205149 CCTGTTAAGCAGATTGGTTAAGG - Exonic
1160090387 18:75821333-75821355 TCAGTCAAGCAGGTTGTGTAGGG + Intergenic
1166386355 19:42383973-42383995 CAAGATAGGCAGATTGTTTGAGG + Intergenic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1166809846 19:45508424-45508446 CCAGTTAAGCAGATTGTGTGCGG - Intronic
1167228926 19:48269362-48269384 CCAGTTAAGCAGAGTCAGGGTGG + Intronic
927050325 2:19321659-19321681 CCAGTGAACCAGAATGTTTGAGG - Intergenic
934772105 2:96913668-96913690 CCAGCCAAGCAGGTTCTGTGTGG - Intronic
935657406 2:105436208-105436230 TCAGTAAACCAGATTTTGTGGGG + Intronic
938586570 2:132696561-132696583 CAAGTTAAGAAGTTTATGTGGGG + Intronic
945905766 2:215591191-215591213 CCAGTTAACTAGAATATGTGTGG - Intergenic
1169713754 20:8592963-8592985 CCAGTTAATCAGAATCTCTGAGG + Intronic
1170123578 20:12937119-12937141 TCAGGTGAGCAGATTGTTTGAGG - Intergenic
1178289389 21:31354068-31354090 CGAGGTGGGCAGATTGTGTGAGG - Intronic
1181475700 22:23166707-23166729 CCAGTTAACAACATCGTGTGAGG - Intergenic
1183461256 22:37952356-37952378 CCAGTGAAGGAAAATGTGTGAGG + Intronic
949264263 3:2138549-2138571 TTAGTAAAGCAGATTGTGAGTGG + Intronic
953812528 3:46126100-46126122 CCAGTTAAGCCAACTGTCTGGGG - Intergenic
955559532 3:60173690-60173712 CCAGTTGAGCAGACAGCGTGAGG - Intronic
956542656 3:70359496-70359518 GCAGTTAAGCAGCTTTTTTGTGG - Intergenic
959207520 3:103329530-103329552 CCAAATAAGAAAATTGTGTGAGG - Intergenic
960296923 3:115955758-115955780 CCAGCTAAGCAGGTAGGGTGTGG - Intronic
960795024 3:121476396-121476418 CCAGTTAACCAGATTGCTTTGGG - Intronic
961958029 3:130824506-130824528 CCAGGTAAGCAGATAGTCAGAGG - Intergenic
963046466 3:141106269-141106291 CCAGTTGGGGAGATAGTGTGGGG + Intronic
965299903 3:166996362-166996384 CCTGTTAAACAGTTTGTGTCAGG + Intergenic
969930719 4:10628252-10628274 CCAGTGAGGGAGTTTGTGTGAGG - Intronic
971136658 4:23876484-23876506 CCAGCTATGCATATTGTGTGAGG + Intronic
972765384 4:42149201-42149223 CCATTTAAGCATACTGGGTGGGG - Intronic
972915191 4:43868497-43868519 CTGGTTAACCAGTTTGTGTGAGG + Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
981768775 4:148282634-148282656 CCAGTTAAACACAGGGTGTGTGG + Intronic
984995063 4:185422817-185422839 CCAGTTAATCAGAATCTCTGGGG - Intronic
985030837 4:185787722-185787744 CCAGCAACGCAGATTGTGGGCGG + Intronic
985536241 5:467221-467243 GCACTTAAGCAGATGGGGTGCGG - Exonic
986670580 5:10139569-10139591 CCAGATCAGCTGATTCTGTGCGG + Intergenic
986817122 5:11425203-11425225 CCAGTGAAGTATATTGTGTGAGG - Intronic
987034016 5:14001781-14001803 ACAGCTAAGCACATTGTGTAAGG + Intergenic
987106718 5:14646973-14646995 CCAGTTCAGCCGTTTGTTTGAGG - Intergenic
987992016 5:25224713-25224735 CAAATTAAGCAGCATGTGTGTGG - Intergenic
995019962 5:107354921-107354943 CAAATTAAGCAGATGGTGTTAGG + Intergenic
995232971 5:109791726-109791748 ACAGGTAAACAGTTTGTGTGTGG + Intronic
996326234 5:122277596-122277618 TCAGTTGAGCATATTTTGTGTGG - Intergenic
996360853 5:122644326-122644348 CTAGTTGGGCAGTTTGTGTGGGG + Intergenic
999238984 5:150116673-150116695 ACAGTGAAGCAGCTTGTCTGAGG + Intronic
1000373945 5:160562011-160562033 CAAGTTCAGCTGATTCTGTGTGG + Intergenic
1000674213 5:164100924-164100946 CCAGAGAAGCATATTGTATGTGG + Intergenic
1004914574 6:20319964-20319986 ACAGTTAAGGAGAGTGTGTCTGG - Intergenic
1007415683 6:41689912-41689934 CCAGATAAGTAGGTTGGGTGAGG - Intronic
1008104577 6:47428297-47428319 CAAGTTGGGAAGATTGTGTGAGG - Intergenic
1010404843 6:75493003-75493025 CTAGCTAAGCAGCTTGTGTTTGG - Intronic
1012229803 6:96747564-96747586 TCAGTTAATCAGATTCTGTTGGG - Intergenic
1013044082 6:106466743-106466765 CAAGTTAAGTAGAATGTGTTTGG + Intergenic
1015100281 6:129470204-129470226 CTAGTTTAGTAGATTGGGTGGGG + Intronic
1015465106 6:133540283-133540305 CCTGTTAAGCAGAATGTTGGAGG - Intergenic
1016509687 6:144827611-144827633 ACAGTTGAGGAGATTGTGAGGGG - Exonic
1017021008 6:150140893-150140915 CCATATAAGCTGATTCTGTGTGG + Intergenic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1030455848 7:109772890-109772912 GCAGTGAAGCAGACTCTGTGAGG - Intergenic
1031447325 7:121871376-121871398 ACATTTGAGCAGATTGAGTGGGG - Intergenic
1032161591 7:129514943-129514965 CCAGTTTAGCAGACTGCCTGAGG + Intergenic
1035237260 7:157506563-157506585 CCAGTTAGGCAGACTCTGGGCGG - Intergenic
1036538386 8:9675815-9675837 GCAGTTAAACAGATTGTCTTAGG - Intronic
1036617105 8:10396802-10396824 CCAGTAAAGCCGATGGTCTGGGG + Intronic
1040822768 8:51583222-51583244 CCAGTTCAGCAGGTTGTATGAGG + Intronic
1046316889 8:112515006-112515028 TAAGTTAAGCAGGTTGTGTGAGG - Intronic
1055183024 9:73413050-73413072 ACTGTTAATCAGTTTGTGTGTGG - Intergenic
1057814599 9:98285255-98285277 CCTGTTCAGCAGCGTGTGTGAGG + Intergenic
1061383040 9:130270320-130270342 CCAGTTAGGCAGATTTTCTAGGG + Intergenic
1185866121 X:3625534-3625556 CCAGTTGACCAGATTGGGTAAGG + Intronic
1200797705 Y:7356795-7356817 CCAGTTGACCAGATTGGGTAAGG - Intergenic