ID: 1166810113

View in Genome Browser
Species Human (GRCh38)
Location 19:45509333-45509355
Sequence GTCCCGGAGGAAGAGGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166810113 Original CRISPR GTCCCGGAGGAAGAGGGCGA AGG (reversed) Intronic
901054940 1:6444691-6444713 GCCCAGGAGGAAGACGGGGAGGG + Intronic
901139000 1:7015896-7015918 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
901165233 1:7216140-7216162 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
901530402 1:9849219-9849241 GTCCTGGAGGCAGGGGGTGAGGG - Exonic
902410055 1:16207117-16207139 GGCCCGGGGGACGAGGCCGAGGG - Exonic
902479415 1:16703912-16703934 GCCCAGGAGGAAGAGGGGGAGGG - Intergenic
904014575 1:27409827-27409849 GCCCCGGAGGAGGAGGAGGAGGG + Exonic
904256094 1:29255841-29255863 TTCCAGGAGGAAGAGGGCAGAGG - Intronic
905151569 1:35931572-35931594 GTCGCGGAGGAGCAGGGCGAGGG - Intronic
906353874 1:45086145-45086167 GAGCCGGAGGAAGAGAGAGAAGG + Intronic
906805610 1:48776683-48776705 GGCCCGGAGGAATTGGGCGCCGG - Exonic
908166410 1:61463466-61463488 GAGGAGGAGGAAGAGGGCGAAGG - Intergenic
908266486 1:62384436-62384458 GAGCAGGAGGAAGAGAGCGAGGG - Intergenic
908534646 1:65066744-65066766 GTGCCGGAGGAGGAGGAGGAGGG - Intergenic
909375805 1:74940655-74940677 GTCCAGGAGGGAGAGGAGGAAGG - Intergenic
910327787 1:86029905-86029927 GAACCGGAGGGAAAGGGCGAAGG + Intronic
915269980 1:154747032-154747054 GTGCAGGAGGAAGAGGGCCGGGG - Intronic
915590229 1:156866508-156866530 GGGCCAGAGGAAGAGGGGGAGGG - Intronic
915599740 1:156914666-156914688 GGCCCGGAGGCAGAGGGGGCTGG - Exonic
917205024 1:172562963-172562985 GTGCAGGAGGAAGAGAGTGAAGG - Intronic
919826602 1:201507502-201507524 GTCCTGGTGGCAGAGGGTGAGGG + Intronic
921067512 1:211633124-211633146 GTCCCGGAGGAAGACAGTGAGGG + Intergenic
922614599 1:226954382-226954404 GTTCTGGAGGAAGAGAGGGAAGG - Intronic
923153442 1:231255216-231255238 GTTCCTGAGGATGAGGGAGAGGG - Intronic
923555534 1:234997811-234997833 GTGCAGGAGGAAGAGGAAGAGGG - Intergenic
923630963 1:235649463-235649485 GTCCCGGGAGAGGAGGCCGAGGG + Intronic
924772407 1:247089086-247089108 GTCCTGGAGCAAGAGGTCCAAGG - Intergenic
1062836070 10:636670-636692 GTCCCTGACGAAGATGGGGAAGG - Intronic
1064769590 10:18710456-18710478 GTCGCGGAGGAAGGGGGCACAGG + Intergenic
1065689543 10:28319165-28319187 GAGCAGGAGGAAGAGGGTGAAGG + Intronic
1065798646 10:29330982-29331004 GCCCCAGAGGAAGAGGGACAAGG + Intergenic
1066180740 10:32958382-32958404 TTTCCGGAGGGAGAGGGCGGCGG - Intronic
1069920575 10:71813168-71813190 CTCCCAGAGGGAGTGGGCGAGGG + Intronic
1075788770 10:125068610-125068632 GTCCCGGAACAAGATGGCCAGGG + Intronic
1075802081 10:125160185-125160207 GAGGAGGAGGAAGAGGGCGAAGG - Intronic
1076513924 10:131032666-131032688 GTCCTGCATGAAGAGAGCGAAGG + Intergenic
1077150773 11:1072190-1072212 CCACCGGAGGAAGAGGGAGAGGG - Intergenic
1077556510 11:3228608-3228630 GTCCAGGAGGTAGATGGCGAAGG + Exonic
1078451128 11:11441776-11441798 GCCCTGGAGGAGGAGGGAGATGG - Intronic
1078561623 11:12377758-12377780 GGCCCGGAGGAAGAAAGCCAAGG + Exonic
1081441341 11:43084949-43084971 GACCAGGAGGAAGAGAGTGAAGG + Intergenic
1084181857 11:67450880-67450902 GGCCCGGAGGAGGAGAGGGAGGG + Intergenic
1084664377 11:70568650-70568672 GGCCGGGAGGAAGTGGGCGGGGG - Intronic
1092957030 12:13560597-13560619 CTCCAGGAGGAAGAAGGCGAAGG - Exonic
1093762023 12:22921398-22921420 GTGCTGGAGGAAGAGTGAGAGGG - Intergenic
1094393018 12:29973619-29973641 GAGCAGGAGGAAGAGGCCGAGGG - Intergenic
1096649034 12:53053001-53053023 GTCCTGAAGGAAGAGGACCAGGG - Intronic
1096847199 12:54413825-54413847 CACCCAGAGGAAGAGGGAGAGGG - Intronic
1098606520 12:72397312-72397334 GTCCAGGAGGAAAAAGGTGATGG - Intronic
1100762651 12:97826429-97826451 GTCCAGGAGGAAGATGATGATGG + Intergenic
1102716891 12:114981601-114981623 GTCCCGGAGGCAGAGAGCTGGGG + Intergenic
1102722441 12:115028968-115028990 TTCCCTGAGGAAGAGGGCTTGGG - Intergenic
1103779502 12:123389399-123389421 GACCCGGGGGAAGCGGGGGAGGG - Intronic
1105011692 12:132761133-132761155 GGGCCAGAGGAAGAGGGAGAAGG - Intronic
1106182270 13:27380095-27380117 GTCCAGGAAGAAGAGGCCGTGGG + Intergenic
1106415617 13:29543684-29543706 GTTCCGCAGGAGGAGGGAGAGGG + Intronic
1106458950 13:29951575-29951597 GAGCAGGAGGAAGAGAGCGAAGG + Intergenic
1112039649 13:95533957-95533979 GTCCCTGAGGAAATGGGCGGGGG - Intronic
1112582238 13:100686454-100686476 GGGCAGGAGGAAGAGAGCGAAGG - Intergenic
1113679500 13:112233404-112233426 GACCCTGAGGAAGAGGACGCTGG - Intergenic
1113927472 13:113949800-113949822 GTCCCCAAGGCAGGGGGCGATGG - Intergenic
1114537553 14:23432574-23432596 GGCCGGGAGGGAGAGGGAGAAGG - Intronic
1117068605 14:52035270-52035292 GTTCAGGAGGAAGAAGGAGAAGG - Intronic
1117105805 14:52395835-52395857 GTCCCGGAGGGAGAGGGGAGAGG - Intergenic
1117957061 14:61130970-61130992 GTCCTGGAGGAGGAGGGAGGAGG - Intergenic
1118838670 14:69494955-69494977 GACCTGGAGGAGGAGGACGATGG - Intronic
1119915461 14:78397265-78397287 GTCCAAGAGGAAGAGGACAAAGG - Intronic
1121938687 14:98045627-98045649 GTGCAGGAGGAAGAGGGTGAAGG - Intergenic
1122159770 14:99774487-99774509 GTCCCAGAGGAGGAGGGTGAGGG - Intronic
1122200787 14:100121328-100121350 GGCCAGGAGTAAGGGGGCGATGG + Intronic
1122656795 14:103267473-103267495 GAGCGGGAGGAAGAGGGTGAAGG + Intergenic
1125716111 15:41820881-41820903 GACCCAGAAGAAGAGGGCGCTGG + Exonic
1125763187 15:42112691-42112713 GACCAGGAGGAAGAGAGAGAAGG + Intergenic
1126849138 15:52787050-52787072 GTTCCGGAGGGAGTGGGCGAAGG - Intronic
1128831425 15:70772743-70772765 GTCATGGAAGAAGAGGGCCAAGG + Intergenic
1131091084 15:89625365-89625387 GCCCAGGAGGAAGAGGGCGGTGG + Exonic
1131525706 15:93150861-93150883 GTCCCGGGGGAAGAGGTTAAAGG + Intergenic
1132000982 15:98179890-98179912 GTCCCAGAGGAAGAAGGAGATGG + Intergenic
1133228281 16:4353729-4353751 GGCCAGGAGGAAGAGGAAGAAGG - Intronic
1135636757 16:24083939-24083961 GTCCAAGATGAAGAGGGAGATGG + Intronic
1135787566 16:25364019-25364041 ATCCAGCAGGCAGAGGGCGAGGG + Intergenic
1135936058 16:26781164-26781186 ATCCTGGAAGAAGAGGGCTATGG - Intergenic
1138179156 16:54930713-54930735 GCCGAGGAGGAAGAGGGAGAGGG + Intergenic
1138773027 16:59687519-59687541 GAGCAGGAGGAAGAGGGCAAAGG + Intergenic
1139593469 16:67945582-67945604 GTCCCATAGGAAAAGGGGGATGG + Intronic
1141278074 16:82606094-82606116 GTCCAGGGGGAAGAGGGCTAAGG - Intergenic
1142518820 17:491239-491261 GTCCCGCTGGGACAGGGCGAGGG - Intergenic
1142631208 17:1228156-1228178 GTCTGGGAGCAAGAGGGCAAGGG - Intronic
1142707865 17:1708028-1708050 GACCAGGCGGAAGAGGGCCAAGG + Exonic
1142895571 17:2975653-2975675 GTCCAAGAGGAAAAGGGGGAAGG - Intronic
1145903796 17:28505695-28505717 GCCCCTGAGGGAGAGGGAGATGG + Intronic
1147184550 17:38706094-38706116 CTCCTGGAGGAAGAGGTCAAGGG + Intronic
1147314693 17:39614038-39614060 TTCCCGGAGGAGGAGGGCCTGGG - Intergenic
1151816884 17:76475528-76475550 GTCCCGGAGGAGGATAGAGAGGG - Intronic
1153632641 18:7086709-7086731 GTCCCTGAGGGAGAGGCAGAGGG - Intronic
1157312123 18:46560383-46560405 GGCCCGGAAGAAGAAGGAGAAGG - Intronic
1158090930 18:53712458-53712480 GTCCCAGAGGCTGAGGGGGAAGG - Intergenic
1159777719 18:72623079-72623101 GAGCAGGAGGAAGAGAGCGAAGG + Intronic
1160804268 19:984909-984931 GTTCTGGAGGAAAAGGGAGAAGG + Intronic
1161196027 19:2987245-2987267 GTCCCTGAGGGTGAGGGGGAAGG + Intronic
1162930741 19:13956296-13956318 GGCCCGGAGCAAGGGGGGGAGGG - Intronic
1163666394 19:18605992-18606014 GTCCCGCAGGGGGAGGGCGGTGG + Intronic
1163692550 19:18745437-18745459 GGCCCGGAGAGAGAGGGCGGAGG + Intronic
1165458156 19:35926956-35926978 GTGCCTGAGGAACAGGGAGAAGG + Intergenic
1165591693 19:36974197-36974219 GTTATGGAGGAAGAGGGCTACGG + Intronic
1165745158 19:38226299-38226321 GTCCGGGTGGAAGAGGGGAAGGG - Intronic
1166231582 19:41428019-41428041 GGCCAGGAGGGAGAGGGGGAGGG + Intronic
1166810113 19:45509333-45509355 GTCCCGGAGGAAGAGGGCGAAGG - Intronic
1167072167 19:47227696-47227718 GTCCCGGCGGAGGAAGGAGAGGG - Intronic
1167094476 19:47367054-47367076 GTCCCGGAGGTAGAGGATGGCGG - Exonic
1168510409 19:56969053-56969075 GTCCCGGGGGAAGAGCACAAGGG - Intergenic
1202713454 1_KI270714v1_random:29818-29840 GCCCAGGAGGAAGAGGGGGAGGG - Intergenic
925006199 2:444848-444870 GTCCCGGGAGAAGAGGGCACAGG - Intergenic
925929858 2:8698290-8698312 GAGCAGGAGGAAGAGAGCGAAGG - Intergenic
927483907 2:23475780-23475802 CGCACTGAGGAAGAGGGCGAGGG - Intronic
929462345 2:42112188-42112210 GTCCAGGAGGAAGAGAGAGGGGG - Intergenic
932418198 2:71586347-71586369 CTCCCTGAGGTAGAGGGAGAAGG + Intronic
932621817 2:73269268-73269290 GTCGCCGGGGAAGTGGGCGAGGG + Exonic
933636437 2:84713542-84713564 GACCAGGAGGGAGATGGCGAGGG - Intronic
933704835 2:85281895-85281917 GTACAGGAGCAGGAGGGCGATGG - Intronic
935235879 2:101138066-101138088 GAGCAGGAGGAAGAGGGAGAGGG + Intronic
935285327 2:101559409-101559431 GACCCGGAGGGAGAGGCTGAGGG - Intergenic
937296615 2:120813332-120813354 TTCCCGGAGGAGGTGGGGGATGG + Intronic
938168787 2:129056828-129056850 GTCCAGGAGGGAGAGGACTATGG - Intergenic
940279663 2:151976355-151976377 ATCACGGAGGAAGTGGGGGAAGG - Intronic
944662669 2:201934237-201934259 ATCCTGGAGGAAGAGAGGGAGGG + Intergenic
946375941 2:219309044-219309066 GTCTCGGAGGAAAGGGGCGTAGG - Intronic
948793627 2:240391489-240391511 GTCCTGGAGGAAGAGGGGGTGGG - Intergenic
949000416 2:241610085-241610107 GGCCCCGAGGAAGAGGCCAAGGG + Intronic
1169560263 20:6792368-6792390 GTCAGTGAGGAAGAGGGAGAAGG + Intergenic
1171011908 20:21513557-21513579 GGTCCGGAGGAAGAGAACGAGGG - Exonic
1172100902 20:32483585-32483607 GGCCCGGAGGAAGGGGGAGGGGG + Intronic
1172519918 20:35559801-35559823 TTCCCAGTGGAAGAGGGCCAAGG + Intergenic
1173530827 20:43768135-43768157 GTCCCTGAGGAGGAGAGAGAGGG + Intergenic
1173900882 20:46588100-46588122 GTCCCGGGTGAAGAGGAGGATGG + Exonic
1174559145 20:51417497-51417519 GACCGGGAGGAAGAGAGTGAGGG - Intronic
1175242895 20:57562827-57562849 GTCCTGGAAGCAGTGGGCGATGG + Exonic
1175263872 20:57691029-57691051 GTCCCGTAGGAAAAGACCGAGGG - Intronic
1175652458 20:60737351-60737373 GAGCAGGAGGAAGAGAGCGAAGG - Intergenic
1178106451 21:29324338-29324360 GGCACGGAGGAAGGGGGCAAGGG - Intronic
1178234268 21:30823232-30823254 GAGCAGGAGGAAGAGGGCAAAGG - Intergenic
1178638778 21:34329311-34329333 GCGCAGGAGGAAGAGGGCAAAGG + Intergenic
1178796054 21:35745387-35745409 GTCCAGGAGGAAGCGAGAGAGGG + Intronic
1178809188 21:35865794-35865816 GGCCAGGAGTAAGAGGGGGAGGG + Intronic
1181853995 22:25769381-25769403 GCCCCGCAGGAGGAGGGCAAAGG + Exonic
1182903771 22:33920203-33920225 GCCCCGGAGGAAGAGGAAGAAGG - Exonic
1183529307 22:38344234-38344256 GGGCAGGAGGAAGAGGGAGAGGG + Intronic
1185296872 22:50058765-50058787 GTCCTGGCGGATGGGGGCGACGG + Intergenic
1185385507 22:50529919-50529941 GATCCGGAGCAAGCGGGCGAGGG - Exonic
949945619 3:9187533-9187555 TTCCCGGGGGAAGAGGCCCAGGG - Intronic
950483633 3:13260096-13260118 GGGCTGGAGGAAGAGGGGGAAGG + Intergenic
952082100 3:29771800-29771822 GTGCAGGAGGAAGAGAGTGAAGG + Intronic
958528958 3:95299631-95299653 GAGCTGGAGGAAGAGGGAGAGGG - Intergenic
959999206 3:112713336-112713358 GAGCAGGAGGAAGAGAGCGAAGG - Intergenic
961555664 3:127695188-127695210 GACCTGGAGGAAGAAGGAGAGGG + Exonic
967557502 3:190876546-190876568 GTCCCGGAGGTAGAGGATGGCGG - Intronic
967596336 3:191329730-191329752 GCCCCGGAGGGAGAGCGCGCGGG + Intronic
968051271 3:195656675-195656697 ATCCCGGAGGGAGAGGGTGGAGG + Intergenic
968104553 3:195991664-195991686 ATCCCGGAGGGAGAGGGTGGAGG - Intergenic
968302844 3:197629247-197629269 ATCCCGGAGGGAGAGGGTGGAGG - Intergenic
969116531 4:4873790-4873812 TTCCAGGAGGAACAGGGCGGTGG + Intergenic
969334374 4:6498958-6498980 GTTCCAGAGGGAGAGGGAGAGGG - Intronic
969655915 4:8498529-8498551 GTGCAGGAGGAAGAGAGAGAGGG + Intergenic
970008062 4:11428987-11429009 GGCCCGGAGGGAGAGCGCGTTGG + Exonic
970935606 4:21566471-21566493 GAGCAGGAGGAAGAGAGCGAAGG - Intronic
970984510 4:22140639-22140661 GAGCAGGAGGAAGAGAGCGAAGG + Intergenic
971534760 4:27735073-27735095 GTCACGGGGGAAGAGTGCAAAGG + Intergenic
972375985 4:38471017-38471039 GTCCAGGAGGAAGAGGAAAATGG - Intergenic
973981826 4:56314307-56314329 CTCTTGGAGGAGGAGGGCGAGGG + Exonic
975321661 4:73015411-73015433 GTTCTGGAGGAAGAGTGGGAAGG - Intergenic
975948338 4:79736704-79736726 GGCCAGGAGGAAGAGAGAGAAGG - Intergenic
976141855 4:82001282-82001304 GAGCAGGAGGAAGAGAGCGAAGG - Intronic
979439455 4:120734111-120734133 GTCCAGGAGGAAGGGGGCACGGG + Intronic
981259929 4:142707568-142707590 GAGCAGGAGGAAGAGGGTGAAGG - Intronic
981941186 4:150283123-150283145 GTTGCGGGGGAAGAGGGCTAAGG - Intronic
982075780 4:151735862-151735884 GACTCGGAGGAAGAGTGGGAAGG + Intronic
982202800 4:152975680-152975702 GACCCGGAGGAAGGCGGGGAAGG + Exonic
985894027 5:2738733-2738755 GTCCCGGAGGCACAGGAGGAGGG - Intergenic
986805120 5:11301948-11301970 GTCCTTGAGGAAGAGGGAGTGGG + Intronic
987286786 5:16465475-16465497 GTCGCGGAGGAGGAGAGCAAGGG - Exonic
987862257 5:23503953-23503975 GAGCAGGAGGAAGAGGGTGAAGG - Intergenic
991457631 5:66821879-66821901 GGCCTGGAGGAAGATGGGGAGGG + Intronic
992006959 5:72487638-72487660 GTCCCTGAGGGAGAGGGACAAGG - Intronic
992648779 5:78836918-78836940 GAGCAGGAGGAAGAGAGCGAAGG + Intronic
993504255 5:88692121-88692143 GCCTCGGAGGAAGAGTGCCAGGG - Intergenic
997867911 5:137481123-137481145 GTATCAGAGGAAGAGGGCGAGGG - Intronic
998107136 5:139475831-139475853 GACCAGGAGCCAGAGGGCGAAGG + Intronic
1001272684 5:170327412-170327434 GTCTCGAAGGAAGGGGGCAAGGG - Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002591886 5:180296117-180296139 TTCCCGGAGGAGGAGGGCTAAGG - Intergenic
1002816318 6:684195-684217 GGACCGCAGGAAGAGGGGGAGGG + Intronic
1005398345 6:25406538-25406560 GTCCAGGAGCAAGAGGGTGGTGG + Intronic
1006580362 6:35073524-35073546 GTCCCTGAGGAAGAGGGGACAGG - Intronic
1006638779 6:35478231-35478253 TGCCAGGAGGAAGAGGGCGTGGG + Intronic
1006889943 6:37418165-37418187 CACCTGGAGGAAGAGGGGGACGG + Intergenic
1007702132 6:43771586-43771608 GAGCCGGAGGAGGAGGCCGAGGG + Intronic
1008032047 6:46707560-46707582 GAGCCGGAGGAAGAGAGGGATGG - Intronic
1019073909 6:169371428-169371450 GTCCTGGAGAAGGACGGCGAGGG - Intergenic
1019502887 7:1374005-1374027 GAACAGGAGGAAGAGGGTGAAGG + Intergenic
1019524116 7:1473071-1473093 GGCCTGGACGAAGAGGGCGAGGG - Exonic
1019573833 7:1726648-1726670 ATCCAGGAGGTAGAGGGAGAAGG - Intronic
1020292505 7:6732703-6732725 GAGCAGGAGGAAGAGGGAGAGGG + Intergenic
1021382613 7:19985656-19985678 GAGCAGGAGGAAGAGGGAGAAGG - Intergenic
1022724888 7:32972202-32972224 GCCCCGGAGGTAGAGGGTGGAGG + Intronic
1023538256 7:41236902-41236924 GTCCCTGAGGAAGAGGCCGTGGG - Intergenic
1023827386 7:44018768-44018790 ATCCCAGAGGAAAAGGGCTATGG + Intergenic
1024107429 7:46107539-46107561 GTCCCGGAGGGAGAGGGCCTTGG + Intergenic
1025048710 7:55715625-55715647 GCCCCGGAGGTAGAGGGTGGAGG - Intergenic
1025916035 7:65866854-65866876 GTCGAGGAGGAAGAGGAGGAGGG + Intergenic
1027189013 7:75987286-75987308 CTGCCGGAGGAATAGGGTGAGGG + Intronic
1029319710 7:99747802-99747824 GTCCAGGAGGAAGGGGGAAAAGG + Intergenic
1029738542 7:102478515-102478537 ATCCCAGAGGAAAAGGGCTATGG + Intronic
1029755672 7:102572179-102572201 ATCCCAGAGGAAAAGGGCTATGG + Intronic
1029773621 7:102671259-102671281 ATCCCAGAGGAAAAGGGCTATGG + Intronic
1031401364 7:121329172-121329194 TGCAAGGAGGAAGAGGGCGAGGG + Exonic
1033273125 7:139950683-139950705 GTCCCGTAGATGGAGGGCGAGGG - Intronic
1033273134 7:139950707-139950729 GTCCCGTAGATGGAGGGCGAGGG - Intronic
1033273143 7:139950731-139950753 GTCCCGTAGATGGAGGGCGAGGG - Intronic
1033273152 7:139950755-139950777 GTCCCGTAGATGGAGGGCGAGGG - Intronic
1033273161 7:139950779-139950801 GTCCCGTAGATGGAGGGCGAGGG - Intronic
1033273178 7:139950827-139950849 GTCCCGTAGATGGAGGGCGAGGG - Intronic
1033273187 7:139950851-139950873 GTCCCGTAGATGGAGGGCGAGGG - Intronic
1033453671 7:141483354-141483376 TTCCCGGGGAAAGAGGGCCATGG - Intergenic
1035165954 7:156990014-156990036 GTCCGGGAGGACGAGGGCCCAGG - Intergenic
1035168254 7:157004055-157004077 GCCCCGGAGGAGACGGGCGACGG - Intronic
1036528369 8:9556324-9556346 GTCGGGGAAGAAGAGGACGACGG - Exonic
1036967755 8:13319567-13319589 GCGCTGGAGGAAGAGGGCGAGGG - Intronic
1037046961 8:14318227-14318249 GAACAGGAGGAAGAGGGAGAAGG + Intronic
1037941710 8:22956462-22956484 GACCAGGAGGAGGAGGGGGAGGG - Intronic
1038043969 8:23750529-23750551 GACAGGGAGGAAGAGGGAGAGGG - Intergenic
1039293244 8:36121592-36121614 GCCTCGGAGGAGGAGGACGAGGG + Intergenic
1039921412 8:41896646-41896668 GTTCCGGACGCGGAGGGCGAGGG + Exonic
1040007505 8:42632731-42632753 GCCCTGCAGGAAGAGGACGAAGG + Intergenic
1041020243 8:53631660-53631682 GGCCAGGAGGCAGAGGGAGAGGG + Intergenic
1041373930 8:57193370-57193392 GTCCAGGAGGAAGAAGGGGGTGG + Intergenic
1042324010 8:67509027-67509049 GAGCAGGAGGAAGAGAGCGAAGG + Intronic
1042985851 8:74582030-74582052 GTCCTGGAGGAAGAGTGTGAGGG + Intergenic
1043116102 8:76255361-76255383 GTCCCCCAGGAAGAGTGCCAAGG - Intergenic
1044881368 8:96726539-96726561 GAACAGGAGCAAGAGGGCGAGGG + Intronic
1045479021 8:102577865-102577887 TCCCCGGAGGCAGAGGGTGAGGG - Intergenic
1047682073 8:127264516-127264538 GAGCAGGAGGAAGAGGGCAAAGG + Intergenic
1048375845 8:133821860-133821882 GCGCAGGAGGAAGAGGGCAAAGG + Intergenic
1049501518 8:142970249-142970271 GTGCAGGAGGAAGTGGGGGAAGG + Intergenic
1049998398 9:1051785-1051807 GACGCGGAAGAAGAGGGCGACGG + Exonic
1051582589 9:18694059-18694081 GACAAGGAGGAAGAGGGCAAAGG + Intronic
1052542549 9:29829029-29829051 GTACAGGAGGAAGAGAGAGAAGG - Intergenic
1056761888 9:89421247-89421269 GTTCCGGAGGCAGAGAGCAATGG + Intronic
1058015964 9:100032225-100032247 GCCCTGGAGGAACAGGGCCAGGG - Intronic
1058446815 9:105062227-105062249 ATCCCGGAGGCAGAGTGCGGTGG + Intergenic
1059490891 9:114666584-114666606 CTCCATGAGGAAGAGGGCGGTGG - Intergenic
1060264420 9:122102183-122102205 GCCCTGGAGGAAGAGGCCCAGGG - Intergenic
1061574892 9:131500077-131500099 GAACCGGAGGGAAAGGGCGAGGG - Exonic
1061650485 9:132044433-132044455 CTCCCAGAGGGAGAGGGAGAAGG + Intronic
1061876049 9:133544631-133544653 GTCCTGGAGGAAGGGGTCCAGGG - Intronic
1185603540 X:1354801-1354823 GTGGAGGAGGAAGAGGGTGAAGG + Intronic
1186379014 X:9037389-9037411 GTCCAGGAGGAAGGGGGTCAGGG + Intronic
1190677713 X:52796447-52796469 GTCCAAGAGGAGGAGGACGAAGG - Exonic
1191708843 X:64125538-64125560 CTACCAGAGGAAGAGGGTGAGGG + Intergenic
1192912893 X:75623996-75624018 GAGCAGGAGTAAGAGGGCGAGGG + Intergenic
1194846068 X:98811109-98811131 GAGCAGGAGGAAGAGAGCGAAGG + Intergenic
1196169586 X:112573128-112573150 GACACAGAGGAAGAGGGCCAGGG - Intergenic
1196894031 X:120315858-120315880 ATCTAGGAGGCAGAGGGCGAGGG + Intergenic
1197753565 X:129980885-129980907 GACCCGCAGGGAGAGGGCGAGGG + Intergenic
1197915606 X:131530961-131530983 GAGCAGGAGGAAGAGAGCGAAGG - Intergenic
1198081262 X:133242026-133242048 GAGCAGGAGGAAGAGAGCGAAGG + Intergenic
1198778714 X:140210422-140210444 GAGCAGGAGGAAGAGAGCGAAGG - Intergenic
1199092877 X:143712315-143712337 GTCCAAGAGGAGGAGGACGAAGG - Exonic
1199215458 X:145255833-145255855 GTCCAAGAGGAGGAGGACGAAGG + Exonic