ID: 1166826564

View in Genome Browser
Species Human (GRCh38)
Location 19:45613514-45613536
Sequence GTCCCTTGGGGAGATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 450}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166826564_1166826573 -1 Left 1166826564 19:45613514-45613536 CCATCCCCATCTCCCCAAGGGAC 0: 1
1: 0
2: 3
3: 47
4: 450
Right 1166826573 19:45613536-45613558 CTCACTCGAGGCTGACAGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1166826564_1166826575 12 Left 1166826564 19:45613514-45613536 CCATCCCCATCTCCCCAAGGGAC 0: 1
1: 0
2: 3
3: 47
4: 450
Right 1166826575 19:45613549-45613571 GACAGCAGGGGTAGCTAAACAGG 0: 1
1: 0
2: 1
3: 4
4: 89
1166826564_1166826574 0 Left 1166826564 19:45613514-45613536 CCATCCCCATCTCCCCAAGGGAC 0: 1
1: 0
2: 3
3: 47
4: 450
Right 1166826574 19:45613537-45613559 TCACTCGAGGCTGACAGCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 200
1166826564_1166826572 -2 Left 1166826564 19:45613514-45613536 CCATCCCCATCTCCCCAAGGGAC 0: 1
1: 0
2: 3
3: 47
4: 450
Right 1166826572 19:45613535-45613557 ACTCACTCGAGGCTGACAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166826564 Original CRISPR GTCCCTTGGGGAGATGGGGA TGG (reversed) Intronic
900724658 1:4208060-4208082 GTCCCTTGGGAGGATGGGATTGG + Intergenic
900741170 1:4332221-4332243 CTCCCCTGGGGAGCTGGGAAGGG + Intergenic
901325206 1:8361234-8361256 GTCCCTGGAGGAGCTGAGGAGGG + Exonic
901690003 1:10966693-10966715 TTCACGTGGGGAGATGGGGTTGG - Intronic
902114890 1:14113254-14113276 GTCTCTTAGGGAGTTGGGGCTGG + Intergenic
902176983 1:14657745-14657767 GTGCTCTGGGGGGATGGGGAAGG - Intronic
902277886 1:15352494-15352516 GGCCCTTTGGGAGGTGGGGCAGG - Intronic
902331595 1:15733664-15733686 TTCCCAGGGAGAGATGGGGAGGG + Intronic
902469874 1:16641653-16641675 GGCTTGTGGGGAGATGGGGATGG + Intergenic
902588783 1:17458721-17458743 GTCTCTTGGGGAGAAGGGGGAGG - Intergenic
902803702 1:18847599-18847621 CTGCCTTGTGGAGTTGGGGAGGG - Intronic
903012762 1:20342948-20342970 GTTCCCTGGGGAGATGGAGTGGG + Intronic
903249852 1:22044916-22044938 GGCCCTTGGGGAGATGGTGGTGG + Intergenic
903291263 1:22315690-22315712 GTCCCTGGGGGACACGTGGATGG + Intergenic
903829320 1:26165090-26165112 GTTCCTTGGGGAACTGGGGTTGG + Intergenic
904500639 1:30910782-30910804 GCACCTTGGGGAGATGGGCAGGG + Intergenic
905627624 1:39498981-39499003 GGCCCTTGGGAAGAAGGGGCCGG + Intronic
905668801 1:39778127-39778149 GACCCTTGGGAAGAAGGGGCCGG - Intronic
905792386 1:40797131-40797153 CTCCCTGGGGGAGATGGGCTGGG + Intronic
906176771 1:43781201-43781223 GTCACTTGGGGAGATTTGAATGG + Intronic
907098323 1:51802686-51802708 GTTCCATGGGGAGATGGAGAAGG + Intronic
908704064 1:66930984-66931006 GTACCTTGGGGAGCGGGAGATGG - Intronic
910123495 1:83815782-83815804 CTCCCTTGGGCAGATGGATATGG + Intergenic
910665549 1:89722469-89722491 GGCAGGTGGGGAGATGGGGAGGG - Intronic
911431372 1:97792222-97792244 TTCTCTTTGGGAGATGGGCAAGG - Intronic
913253833 1:116936519-116936541 GATCCTAGGGGAGTTGGGGAAGG + Intronic
915655903 1:157360263-157360285 GTCCCTGGGCCAGCTGGGGAGGG - Intergenic
915673429 1:157509638-157509660 GTCCCTGGGCCAGCTGGGGAGGG + Intergenic
916015429 1:160745334-160745356 GTCCCTTAGGGGGATGGAGAAGG + Intronic
916016099 1:160750988-160751010 GTCCATGTGGGTGATGGGGAGGG + Intronic
916438592 1:164799754-164799776 CTCCTTTGGGGAGATGGGCCTGG - Exonic
916492761 1:165316300-165316322 TTACCACGGGGAGATGGGGAGGG + Intronic
919895606 1:202008081-202008103 GTGCCTTGGAGGCATGGGGATGG - Exonic
920313997 1:205065048-205065070 GGCCCTTGGGTGGATGGGGGAGG - Intronic
920440146 1:205975504-205975526 CTCCCTAGGTGCGATGGGGATGG - Intergenic
921604546 1:217138314-217138336 GCCCCTTGGGGAGACGAGGAGGG + Intergenic
922056578 1:222048078-222048100 GTTCCTTTGGGAAATGGGGAAGG - Intergenic
922569557 1:226625942-226625964 GACCCTTGTGGAGCTGGTGAAGG - Intergenic
923384476 1:233453003-233453025 GTCTTATGGGGAGATGGAGAGGG - Intergenic
924415397 1:243851011-243851033 GCCCCTTGGGGAGATGGGCCCGG + Intronic
1062825818 10:567874-567896 GTGCTTTGGGGAGCTGGGGTGGG - Intronic
1062836070 10:636670-636692 GTCCCTGACGAAGATGGGGAAGG - Intronic
1063670183 10:8093924-8093946 GCAACTTGGAGAGATGGGGATGG + Intergenic
1063874439 10:10458238-10458260 CTCCCTGTGGGAGATGGGAAAGG - Intergenic
1064261130 10:13787407-13787429 GCCTCCTGGGAAGATGGGGAGGG + Intronic
1066395420 10:35016544-35016566 GTTTCTTGGGGAGGTGAGGATGG + Intronic
1067792061 10:49295835-49295857 ATCCATTGGGGAGCTAGGGAAGG - Intergenic
1068772742 10:60840607-60840629 CTCCATTGAGGGGATGGGGAAGG + Intergenic
1069783610 10:70974045-70974067 GTCACTTGGGGAGAAAGGGTAGG + Intergenic
1069863704 10:71487042-71487064 GCACCTTGGGGAGGTGGGGGAGG - Intronic
1070726527 10:78795318-78795340 GTCCCTCTGGGAGAGGAGGAAGG + Intergenic
1070804887 10:79265154-79265176 AGCCCTTGGGGAGAGGGGGCGGG + Intronic
1071356174 10:84798509-84798531 GTCCCTGGTGGAGAAGGGGAGGG + Intergenic
1072802795 10:98405043-98405065 GGCCCAGGGGGAGATGGGGAAGG + Intronic
1072902524 10:99421216-99421238 GTCTCTTGGGGAGATGCAGAAGG - Intronic
1073062035 10:100738967-100738989 GGCCCTCGGGGAAAGGGGGAAGG - Intronic
1074346655 10:112692858-112692880 GTCTGGTGGGGAGATGGGCAAGG - Intronic
1075463432 10:122633527-122633549 ATCCCGTGGAGAGTTGGGGAGGG + Intronic
1075647395 10:124105342-124105364 GTGCCTTGGAGGCATGGGGAAGG - Intergenic
1075780839 10:125016169-125016191 GTCCCTTGGGGCACTGGGAAGGG - Intronic
1076200620 10:128554845-128554867 GTGCCTGGGAGAGATGGGGGAGG + Intergenic
1076364975 10:129915896-129915918 GGCCCCTGGGGAGACGGGGAGGG + Intronic
1076385744 10:130053852-130053874 GTCCCTGGGAGAGTGGGGGAAGG + Intergenic
1076760956 10:132605464-132605486 ATCCCTTGGAGGGATGGGGAAGG + Intronic
1077069289 11:660583-660605 GTTCCCTGGGGACACGGGGATGG + Intronic
1078563112 11:12390288-12390310 GCCCCTGGTGGGGATGGGGAAGG + Intronic
1078585103 11:12578390-12578412 GTCTCCTGGTCAGATGGGGAAGG + Intergenic
1078780687 11:14436387-14436409 GGGACTTGGGGAAATGGGGAGGG - Intergenic
1080059952 11:27946594-27946616 TTCCCTGGTGGAGGTGGGGATGG - Intergenic
1080632908 11:34095664-34095686 GTACCTTTGGGAGGTGAGGAAGG - Intronic
1081565173 11:44256303-44256325 GACCCTTTTGGATATGGGGATGG + Intergenic
1081590119 11:44416776-44416798 AAGGCTTGGGGAGATGGGGATGG + Intergenic
1083627825 11:64080821-64080843 AACTCTTGGGGTGATGGGGAGGG + Intronic
1083823159 11:65183624-65183646 GGCACTGGGGGAGATGCGGAAGG + Intronic
1084171837 11:67404654-67404676 GTAGCTTGGGGAAAGGGGGAAGG - Intronic
1084202720 11:67572468-67572490 GTCCCTTGGAGAGATTGGTCTGG + Intergenic
1084271670 11:68032546-68032568 CTCCCTGGGTGTGATGGGGAGGG + Intronic
1084292812 11:68186209-68186231 GTTCCTTGGAGAGAAGGGGGTGG - Intronic
1084427510 11:69093725-69093747 ACCTCTTGGGGAAATGGGGATGG + Intergenic
1084471027 11:69358963-69358985 GCCCCTGGGGGACATGGGGGTGG - Intronic
1084707566 11:70824178-70824200 GTGTCCTGGGGAGGTGGGGAAGG - Intronic
1085306348 11:75488217-75488239 GTCACTGGGGGAGAAGGGGGTGG - Intronic
1086303782 11:85458879-85458901 GACTCTTGGGCAGAAGGGGAAGG + Intronic
1086849801 11:91796319-91796341 GAGCCTGGGAGAGATGGGGATGG - Intergenic
1086912673 11:92491238-92491260 GTCCCTTAGGGACAGGAGGAAGG - Intronic
1088196136 11:107276053-107276075 GTCCCATGGGGACATGGTGATGG - Intergenic
1089512593 11:119009547-119009569 CCTCCTAGGGGAGATGGGGAGGG + Intronic
1089608606 11:119656762-119656784 GACCCTCGGGGAGAGGCGGAAGG - Intronic
1090374973 11:126282314-126282336 GCACCTTGGGGAGAAGGGAACGG - Intergenic
1090428526 11:126627274-126627296 ATTCCTGGGGGAGATGAGGAAGG + Intronic
1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG + Intronic
1091726385 12:2849284-2849306 GTGCCTTGGAGAGATGGTGGAGG + Intronic
1091863180 12:3805469-3805491 GGGCTTTGGGGATATGGGGAAGG - Intronic
1091878500 12:3957440-3957462 GACCCTTTGGGAGAAGGGCATGG - Intergenic
1092163460 12:6328645-6328667 GTCACTTGGCGTGATGGTGATGG + Intergenic
1092568815 12:9699156-9699178 GTCCTTAGGGGAGAGGGAGATGG - Intronic
1093047813 12:14470142-14470164 TTCCCTTGGAGAGATGTGCAAGG + Intronic
1094494451 12:30980665-30980687 GAGTCTTGGAGAGATGGGGAGGG - Intronic
1094521865 12:31199507-31199529 GTGCAGTGGGGAGAGGGGGAGGG - Intergenic
1095310668 12:40693131-40693153 CTCCCTTCAGGAGATGGGGGTGG + Intronic
1095789621 12:46150530-46150552 GTTCCTTGGGGAAGTGGGCATGG + Intergenic
1096070816 12:48774607-48774629 GTCACATGGGGAGAGGGAGAAGG - Intronic
1096446706 12:51699507-51699529 GAGGCTTGGGGAGGTGGGGAGGG + Intronic
1096616096 12:52834381-52834403 TCCCCTTGGGGCGATGGGGCAGG - Intergenic
1096776119 12:53965457-53965479 GTTCCTGGGGGAGAGGGGGAAGG - Intergenic
1097030191 12:56084189-56084211 GTTACCTGGGGAGATGAGGAAGG + Intronic
1097263414 12:57732433-57732455 GTGGCTTGGGGAGCTGGGCAGGG + Exonic
1097709888 12:62906679-62906701 TTCCCTTGGGGTCATGGTGATGG - Intronic
1100932064 12:99620173-99620195 ACCCCTTAGGGAGATGGGAAAGG + Intronic
1102467431 12:113138048-113138070 TCCCCGTGGGGAGCTGGGGAAGG - Intergenic
1103137756 12:118522417-118522439 GTCGGGTGGGGAGATGGGGGAGG - Intergenic
1103329625 12:120145019-120145041 GGCCCTTGGGGCCATGGTGAAGG - Exonic
1103336206 12:120191953-120191975 TTCCACTGGGGAAATGGGGAGGG - Intronic
1103773309 12:123346239-123346261 GTCTTTTGGGGAGATTGGGGTGG - Intronic
1103850131 12:123927763-123927785 GCCCCTGGGTGAGATGAGGATGG + Exonic
1103951870 12:124555732-124555754 GTTCCTTGGGGAGAGGAGCAAGG + Intronic
1103966683 12:124644527-124644549 GGCCCTTGGGGAGGAGGGGAAGG + Intergenic
1104388702 12:128373705-128373727 ATTCCTTTGGGGGATGGGGAAGG + Intronic
1104470946 12:129029162-129029184 GTCCTTTGGGGAGCTGTGGAAGG + Intergenic
1104920947 12:132290402-132290424 GTGTCTTGGGGTGATGGGCACGG + Intronic
1105785145 13:23740874-23740896 TTCCCTTGTGGAGTCGGGGAAGG + Intronic
1106231351 13:27823555-27823577 GGGGCCTGGGGAGATGGGGAGGG + Intergenic
1108473169 13:50787792-50787814 GTCCATCGGGGAGATGGGGGTGG - Intronic
1109208363 13:59506414-59506436 GTCACTTGGGAAAATAGGGAAGG - Intergenic
1109401001 13:61828671-61828693 GTCCCTTGGGGAGTTAGCTAAGG - Intergenic
1110433250 13:75450729-75450751 GACCTTTGGGGAGGTGGGAAGGG - Intronic
1111607664 13:90561791-90561813 CTCTCTTGGGAAGAAGGGGAAGG + Intergenic
1113697182 13:112354799-112354821 GTGCCTTGGGGAGCAGGGGGTGG - Intergenic
1117089526 14:52236130-52236152 GTCTCTGAAGGAGATGGGGAAGG + Intergenic
1118455387 14:65941570-65941592 CTCACCTGGAGAGATGGGGAGGG + Intergenic
1118548392 14:66920288-66920310 TTCTCTTGGGGAGGAGGGGATGG + Intronic
1118719048 14:68580752-68580774 GAACCTTGGGGAAATGGGGCTGG - Intronic
1119189379 14:72670008-72670030 GGCCCCTGGGGCGATGGAGAAGG - Exonic
1119494779 14:75069430-75069452 TGCCCTTGGGGAGCCGGGGAGGG - Exonic
1119729182 14:76940279-76940301 GGCCCTGGGGGAGATGGGGAGGG - Intergenic
1119773610 14:77235964-77235986 GTGGCCTGGGGAGATGGTGATGG + Intronic
1119825740 14:77655615-77655637 TTCCCTTGGGCTGATAGGGAGGG + Intergenic
1120766479 14:88331735-88331757 ATCCCTTGGGGACAAGGGGTGGG + Intergenic
1124442049 15:29692873-29692895 GTCCCTTGGGGGTAAGGGGAAGG + Intergenic
1125538383 15:40455818-40455840 GGCCATTTGGGAGTTGGGGAGGG + Intronic
1125601196 15:40916589-40916611 GGCCCTTGGGGAGGTGCAGAGGG + Intergenic
1127055339 15:55125703-55125725 ATCCCTTTGGGAGGTGGAGAGGG - Intergenic
1127893245 15:63273143-63273165 GTGGGTTGGGGTGATGGGGATGG - Intergenic
1128120606 15:65143325-65143347 GTCCCTTGGGGAGTGGGGCCAGG - Intergenic
1128944313 15:71810895-71810917 GGCCCTTGGGGAGCAGGGTAAGG + Intronic
1129393549 15:75232585-75232607 GACCCTTGGGGAGCTGGGGCTGG + Intergenic
1129450891 15:75650623-75650645 GGGCCCTGGGGAGATGGGGATGG + Intronic
1129674347 15:77624461-77624483 GTGCCTTGGTGAGGTGGGCAGGG - Intronic
1129738855 15:77980171-77980193 GGGCCCAGGGGAGATGGGGAAGG - Intergenic
1129847105 15:78773010-78773032 GGGCCCAGGGGAGATGGGGAAGG + Intronic
1129886774 15:79043686-79043708 GCTACCTGGGGAGATGGGGATGG + Intronic
1130254797 15:82320880-82320902 GGGCCCGGGGGAGATGGGGAAGG - Intergenic
1130600176 15:85269126-85269148 GGGCCCGGGGGAGATGGGGAAGG + Intergenic
1130661976 15:85837919-85837941 GACCAGTGGGGAGGTGGGGAAGG - Intergenic
1131424250 15:92332644-92332666 GTCCCTTGGGGAGCTGTGTAAGG + Intergenic
1131431830 15:92394270-92394292 CTCCGCTGGAGAGATGGGGACGG + Intronic
1132032480 15:98450166-98450188 GGCTCTTGGGGAGCTGTGGATGG - Intronic
1132632956 16:928698-928720 GGCCCGTGGGGATGTGGGGAGGG - Intronic
1132722045 16:1321256-1321278 GACCCGTGGTGAGATGGGGCTGG - Intronic
1133264981 16:4577707-4577729 GTCCCTTGGGAGGATGAGGCAGG + Intronic
1133613878 16:7457709-7457731 GTCCCTGGGAGGAATGGGGAGGG - Intronic
1134094539 16:11411000-11411022 AGCCCTTTGGGAGATGGGGGAGG - Intronic
1134662079 16:15991842-15991864 GATCCTAGGGGAGATGGGAAAGG - Intronic
1134833976 16:17346235-17346257 GCCCCTTGGGGAGGTGAGAACGG - Intronic
1135324602 16:21518509-21518531 GTACTTTGGGGAGAAGGGGGAGG - Intergenic
1136336089 16:29611779-29611801 GTACTTTGGGGAGAAGGGGGAGG - Intergenic
1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG + Intergenic
1136778551 16:32883970-32883992 GTCACTTGGGGTGATGGCCATGG + Intergenic
1136892069 16:33977544-33977566 GTCACTTGGGGTGATGGCCATGG - Intergenic
1137498992 16:48996149-48996171 GTGCCTGGGGCAGATGGGGCAGG + Intergenic
1137975944 16:53032328-53032350 GTGCCATTGGGAGGTGGGGAAGG - Intergenic
1138266787 16:55665356-55665378 CACCCTTGGGGTGTTGGGGAAGG + Intronic
1140122525 16:72096024-72096046 GTCTTAAGGGGAGATGGGGAAGG + Intronic
1140410918 16:74739901-74739923 GTGCCCAGGGGAGAAGGGGAAGG - Intronic
1140913624 16:79475587-79475609 TTTCCTGGGGGAGATGGAGATGG + Intergenic
1141033429 16:80608854-80608876 TTCCCTTGGGGAGACAGGGCTGG - Intronic
1141206915 16:81939666-81939688 GTCCCTTGGTGAGCAGAGGAAGG - Intronic
1141299086 16:82796355-82796377 GTACCCTGGGGAGATGTTGAAGG - Intronic
1141716515 16:85730094-85730116 GCCCCTGGGGGAGCTGAGGAAGG + Intronic
1141801078 16:86309708-86309730 GTCACTTGGGTAGAAGGTGAGGG - Intergenic
1141994250 16:87626693-87626715 GACCCTTGGGAAGGTTGGGATGG + Intronic
1142222640 16:88863197-88863219 GTCCCACGGGGAGACGCGGAGGG + Intergenic
1142222652 16:88863233-88863255 GTCCCACGGGGAGACGCGGAGGG + Intergenic
1142353446 16:89590173-89590195 GTTCCTTCAGGAGATAGGGAAGG + Intronic
1203080968 16_KI270728v1_random:1146064-1146086 GTCACTTGGGGTGATGGCCATGG + Intergenic
1142771641 17:2101912-2101934 TCTCCTTGGGGAGATGGTGAGGG - Intronic
1143564808 17:7715086-7715108 GTCCCCAGGGGAGATGGGGATGG + Intergenic
1144776574 17:17787889-17787911 GTCCCTGGAGGAGATGGTGTTGG + Intronic
1146626502 17:34439256-34439278 GTGCCTTGAGGAGATGGGCTGGG + Intergenic
1147342961 17:39766009-39766031 GTCTCTTGGGCAGATGGGCGGGG + Exonic
1147388150 17:40093661-40093683 CTGCCTGGGGGAGCTGGGGAAGG - Exonic
1147441078 17:40447559-40447581 GTGCCTTGTGGGGAGGGGGAGGG + Intronic
1148095567 17:45050861-45050883 CTCCTTTGCGGAGCTGGGGAAGG + Intronic
1148169859 17:45509846-45509868 GCCCTTTCGGGAGGTGGGGAGGG - Intergenic
1148193683 17:45698200-45698222 TTAGCTTGGGGAGATGGAGATGG + Intergenic
1148279350 17:46335962-46335984 GCCCTTTCGGGAGGTGGGGAGGG + Intronic
1148301567 17:46553817-46553839 GCCCTTTCGGGAGGTGGGGAGGG + Intronic
1148365500 17:47052819-47052841 GCCCTTTTGGGAGGTGGGGAGGG + Intergenic
1148494071 17:48041969-48041991 CTCCATAGGGGAGGTGGGGAAGG + Intergenic
1148495865 17:48053324-48053346 CTCCCTTTGGGAGGTGGGGTGGG + Intronic
1148625558 17:49066545-49066567 CTCCCATGGGTAGATGTGGATGG - Intergenic
1149397727 17:56261951-56261973 GGCCCTTGGGGACCTGGGCAGGG - Intronic
1149869953 17:60172205-60172227 GGACCTTGGGGATAAGGGGACGG - Intergenic
1150136397 17:62697617-62697639 GTCCCTGAGGGAGATGCAGAAGG - Intergenic
1150297556 17:64021184-64021206 GTCACTTGGGAAGTTGAGGAGGG - Intergenic
1150400940 17:64855444-64855466 GCCCTTTCGGGAGGTGGGGAGGG - Intronic
1150859820 17:68790116-68790138 CACTCTTGAGGAGATGGGGAAGG + Intergenic
1151190177 17:72392633-72392655 GTGGGTTGGGGAGATGGAGAGGG - Intergenic
1151460755 17:74252764-74252786 TCCCCTTGAGGAGATGGGCAGGG + Intronic
1151581531 17:74982013-74982035 GTGCATGGGGGAGAGGGGGATGG + Intergenic
1151583997 17:74997451-74997473 GTGCCGTGGGGTGATGGGCAAGG - Intronic
1151685461 17:75643607-75643629 TTCCCTGGGGAAGATGGGCATGG + Intronic
1152010357 17:77709359-77709381 GGCCCTGTGGGAGATGAGGAGGG + Intergenic
1152467314 17:80473690-80473712 CATCCTTGGGGAGATGGGGGTGG + Intronic
1152749878 17:82057707-82057729 GCGCCTAGGGGAGGTGGGGAGGG + Intronic
1152808973 17:82372210-82372232 GTCGCTAGGGGGGAAGGGGAGGG - Intergenic
1152873512 17:82772350-82772372 GGCCCTCGGGGAGCTGGTGAGGG + Intronic
1153620513 18:6973288-6973310 GGCCCTTGGGGAGAAGCAGATGG - Intronic
1156019466 18:32583212-32583234 CTCACCTGGGCAGATGGGGATGG - Intergenic
1156326658 18:36079707-36079729 GCCACTGTGGGAGATGGGGAAGG - Intergenic
1157584763 18:48794018-48794040 CTCCCCTGGGGAGATGGGGATGG - Intronic
1158776861 18:60593342-60593364 GTTCCATGGGGCGATGGAGAGGG + Intergenic
1159003235 18:62991505-62991527 CTCTCCTGGGGAGATGGGTAAGG + Intergenic
1160172086 18:76563337-76563359 CCCTCTTGGGGAGATGGGCAGGG + Intergenic
1160677511 19:399351-399373 GTGACTTTGGGAGATGAGGAAGG + Intergenic
1160961066 19:1721038-1721060 GACCTTTGGGGAGAGGGTGAGGG - Intergenic
1160994612 19:1876861-1876883 GTCCCTAGGAGAGATCGGCACGG - Intronic
1161196027 19:2987245-2987267 GTCCCTGAGGGTGAGGGGGAAGG + Intronic
1161222193 19:3122915-3122937 GCCCCATGGGGAGACGGGGCTGG + Exonic
1161249156 19:3271131-3271153 GCACCTTGGGCAGATGAGGATGG - Intronic
1161396416 19:4047155-4047177 GGCCACTGGGGAGATGGAGAGGG + Exonic
1161548411 19:4896562-4896584 GTCCCATGGGGAGAAGGGAAGGG - Intronic
1161618792 19:5287453-5287475 GGAGATTGGGGAGATGGGGAGGG - Intronic
1161622395 19:5305091-5305113 ATGTCTTGGGGAGATGGGGTTGG - Intronic
1161872117 19:6878247-6878269 ATCCCTTCTGGGGATGGGGATGG - Intergenic
1162107265 19:8377534-8377556 GTCTCTTGGGGAGGTGGTGGGGG + Intronic
1162302753 19:9853551-9853573 GCCCTTTGGGGAGATGGGTGAGG - Intergenic
1162402535 19:10454556-10454578 CTCCTTGGGGGAGATGAGGAGGG + Intronic
1162849118 19:13417095-13417117 CCCCCTTGGGGAGAGGGTGACGG - Intronic
1163004406 19:14388622-14388644 GGCACTGGGGGAGATGGGGCAGG - Intronic
1163007168 19:14404363-14404385 GTCCTGTGGGCAGATGGGGGTGG - Exonic
1163500970 19:17675939-17675961 GTCTCTTGGAGAGACTGGGAGGG - Intronic
1163655913 19:18544642-18544664 TTGCCTTGGGGAGGTTGGGAGGG - Intergenic
1164279930 19:23760197-23760219 GCCCCATGTGGAGATAGGGATGG - Intergenic
1164553418 19:29231642-29231664 GTCGCTTGAGGGGATGGGGGAGG + Intergenic
1164983549 19:32631700-32631722 CTCCCTGTGGGGGATGGGGATGG + Intronic
1165023764 19:32944542-32944564 GTCCAGTGGTGCGATGGGGAGGG + Intronic
1165899981 19:39164863-39164885 GTCCCTTGTGGTGGTGGCGATGG + Intronic
1166735195 19:45079748-45079770 GGCCCCAGGGGAGAAGGGGAGGG + Intronic
1166826564 19:45613514-45613536 GTCCCTTGGGGAGATGGGGATGG - Intronic
1167486610 19:49766791-49766813 TTCCGTTTGGGAGCTGGGGAGGG - Intergenic
1167568558 19:50272404-50272426 GTCCCTGAGATAGATGGGGAAGG + Intronic
1167724319 19:51200320-51200342 GTTCCTGTGGGAGACGGGGATGG - Intergenic
1167793065 19:51692568-51692590 GTTCCTTGGGGAGGAGGGGCCGG + Intergenic
1168278404 19:55289672-55289694 GGCCCTTGGGGGCATGTGGAGGG + Intronic
1168309343 19:55452690-55452712 GACCCTTGGGGAGCCGGGGGTGG + Intergenic
925018970 2:553685-553707 GTCCCAGGAGGAGGTGGGGAGGG + Intergenic
925201189 2:1968836-1968858 GTCCACTGGGGATATGTGGATGG + Intronic
925355346 2:3237111-3237133 GTCCACCTGGGAGATGGGGAGGG + Intronic
925613430 2:5722530-5722552 GGGACTTGGGGGGATGGGGATGG + Intergenic
926475811 2:13320778-13320800 GTTCCTTGTGGAGATGGGATAGG - Intergenic
927103343 2:19804766-19804788 TTCCTTTGGGAAAATGGGGAAGG - Intergenic
928202965 2:29262873-29262895 TTCCCTTGGGGAGCAGGGGGTGG - Intronic
928453426 2:31398740-31398762 GTCCTTTGGGGAGCCTGGGAGGG - Intronic
928723891 2:34149064-34149086 GTCTTTTGGGGTGAGGGGGATGG - Intergenic
929508018 2:42543595-42543617 GTCCCTTGGGAGGATGAGGTGGG - Intronic
931870977 2:66459344-66459366 GTCCCTTGGGGAGATTATGAAGG + Intronic
931913520 2:66928106-66928128 ATACCTTGGGGAGATGGAGTTGG - Intergenic
932269631 2:70398288-70398310 GAACCTTGGGCAGCTGGGGAGGG + Intergenic
932329194 2:70887981-70888003 GTCCTTGGGGTAGATGGTGACGG - Intergenic
933049936 2:77590693-77590715 GCCCCTTGGGGAGGTGGCTAAGG - Intronic
933719694 2:85390045-85390067 CTCCCCTGGGGAAATGGGGAAGG + Intronic
934120348 2:88832115-88832137 GTCCCTTTGGGTGATTGGCACGG + Intergenic
934857860 2:97739967-97739989 GACCCCTGGGAAGATGGGGCTGG + Intergenic
936071117 2:109371954-109371976 GTCCCTTGAGAAAACGGGGAAGG - Intronic
937083474 2:119156580-119156602 CTCCCTTGCCGGGATGGGGATGG + Exonic
937092676 2:119217024-119217046 GGCGCTTCGGGAGATGGGGCTGG - Intergenic
937144048 2:119627153-119627175 GTGCCTAGGGAGGATGGGGAAGG - Intronic
938607454 2:132910388-132910410 GTGCTCGGGGGAGATGGGGATGG - Intronic
940717128 2:157238602-157238624 CTCCCTTGGGGAGAAGGGTTAGG + Intergenic
944230982 2:197392556-197392578 TTCCCTTGGGGAGTTGGGGGGGG + Intronic
945063265 2:205926547-205926569 GTCCTTTGTAGAAATGGGGATGG + Intergenic
946354229 2:219174955-219174977 GCTCTTTAGGGAGATGGGGAGGG + Intronic
947688275 2:232110537-232110559 GTCCTTTGCAGAGATGTGGATGG + Intronic
947749086 2:232523602-232523624 GTCCGTTGGGGCACTGGGGACGG - Intronic
948945234 2:241216009-241216031 GTCCTTGGGGGAGATGTGGCCGG - Intronic
949033164 2:241805968-241805990 GTCCCTTGGGCTGAGGGGGGAGG - Intergenic
949066367 2:241993205-241993227 GCCCCCTCGGGAGCTGGGGACGG - Intergenic
1169498703 20:6138799-6138821 GTCCCCTGAGGAGAGGGGAATGG - Intergenic
1171391249 20:24802899-24802921 GTCCTGTGGGGGAATGGGGAGGG + Intergenic
1173341914 20:42160761-42160783 ATGCTTTGGGGAGATGGGAAAGG + Intronic
1173540075 20:43844400-43844422 GGGCCTTGGGGAGAAGAGGAGGG + Intergenic
1173847677 20:46198379-46198401 GTCCCGGGGAGAGATGGAGAAGG - Intronic
1173883525 20:46437253-46437275 GTTCCTTGGGGATTGGGGGATGG + Intergenic
1174443418 20:50574348-50574370 GCCTCATGGGGAGATGGGGGTGG - Intronic
1175443210 20:59004850-59004872 GTCCCCTGGGGAAATGCGGCAGG + Intronic
1175506790 20:59491879-59491901 ATGGGTTGGGGAGATGGGGAGGG - Intergenic
1175506812 20:59491969-59491991 GTCCTTTGTGTAGTTGGGGAGGG - Intergenic
1176240796 20:64074990-64075012 TCCCCTGGGGGAGATGGGGTGGG + Intronic
1176241223 20:64076807-64076829 TCCCCTGGGGGAGATGGGGTGGG - Intronic
1176998946 21:15588328-15588350 GTTCCAGGTGGAGATGGGGAAGG - Intergenic
1177712423 21:24796219-24796241 GGAGCTTGGGGGGATGGGGATGG - Intergenic
1178232357 21:30801061-30801083 GTGCTTTGGGAAGCTGGGGAGGG - Intergenic
1179030939 21:37718964-37718986 CATCCATGGGGAGATGGGGAGGG + Intronic
1179574587 21:42299789-42299811 GGCCCTGGGGGTGAGGGGGAGGG + Intergenic
1179654647 21:42837699-42837721 GCCCCTCGGGGAGACGGGGGCGG - Intergenic
1179710796 21:43211893-43211915 TGGCCTTGGGGAGCTGGGGAGGG + Intergenic
1180025441 21:45158556-45158578 GGCTCTTGGGGATTTGGGGAGGG + Intronic
1180067706 21:45420862-45420884 GAACCTTGGGGAGCTGTGGATGG + Intronic
1180073470 21:45450176-45450198 GTCCCTGGGGAAGGAGGGGAGGG + Intronic
1180582005 22:16846327-16846349 GGCCCTTGGGGATCTGGGGAAGG + Intergenic
1180615239 22:17121827-17121849 GTGCCTTAGGGAGAGGCGGATGG - Exonic
1180815977 22:18789839-18789861 GTTCCTTGGGGGGAGGGGGGAGG + Intergenic
1181202164 22:21224174-21224196 GTTCCTTGGGGGGAGGGGGGAGG + Intronic
1181276941 22:21693455-21693477 GTCCCTTGATGACATGGGGCTGG + Intronic
1181542925 22:23583643-23583665 GATCCTCGGGGAGATGGGCAAGG + Intergenic
1181584303 22:23844757-23844779 GTCTCTGGGTGGGATGGGGAGGG + Intergenic
1181699531 22:24612453-24612475 GTTCCTTGGGGGGAGGGGGGAGG - Intronic
1183173432 22:36204613-36204635 ATCCCTTGGTAAGTTGGGGATGG - Exonic
1183483556 22:38077646-38077668 GTCCCCTGGGGTCCTGGGGAGGG - Intergenic
1184152562 22:42647215-42647237 CACCCTTGGAGAGATGGGGCTGG + Intronic
1184676464 22:46045734-46045756 GTTCCTTGGGGAGCAGGTGAGGG + Intergenic
1184746760 22:46460720-46460742 GTCCCTTTCGGAGAATGGGATGG + Intronic
1185040499 22:48501494-48501516 TTCCCTTGGAGAGATGGGCCAGG - Intronic
1203224745 22_KI270731v1_random:71254-71276 GTTCCTTGGGGGGAGGGGGGAGG - Intergenic
1203266080 22_KI270734v1_random:15531-15553 GTTCCTTGGGGGGAGGGGGGAGG + Intergenic
949792653 3:7810085-7810107 GACACTTGGTGAGATGTGGATGG - Intergenic
949987621 3:9553009-9553031 GGCCATGGGGGAGTTGGGGAGGG + Intronic
950007158 3:9698658-9698680 GTGCCTTGGGGAGTTGGGAAGGG + Intronic
950644324 3:14368143-14368165 CTCCCATGGGGAGCTGGGGCTGG - Intergenic
953349964 3:42208036-42208058 GTCCCTGGGGGAGTGGGGTACGG + Intronic
953436649 3:42882500-42882522 GCCCCTTGGGAGGGTGGGGAGGG + Intronic
953684344 3:45064617-45064639 GTCCGTGGGGGAGGTGGGGGTGG + Intergenic
953713780 3:45297968-45297990 GCTCCTTGGTGAGATGAGGAGGG - Intergenic
953915089 3:46913985-46914007 CTCCCATGAGGAGATGAGGATGG + Intergenic
954299559 3:49692600-49692622 GGCTTGTGGGGAGATGGGGATGG - Intronic
954358387 3:50102566-50102588 GTCCTTTGGGGGGAAAGGGAGGG - Intronic
955051587 3:55416031-55416053 CTCCTTTGTGGAGATGGGGAGGG - Intergenic
955818145 3:62868887-62868909 CTCTCATGTGGAGATGGGGATGG - Intronic
956508382 3:69967630-69967652 GTCTCTTAAGGAGAAGGGGAGGG - Exonic
960739085 3:120812956-120812978 GTTTCTTAAGGAGATGGGGAAGG + Intergenic
961321963 3:126082897-126082919 GTCCCCTGTGAAGGTGGGGAGGG - Intronic
961329103 3:126128527-126128549 GTCCCCTGTGAAGGTGGGGAGGG + Intronic
961349143 3:126287843-126287865 GACCCTCGCGGTGATGGGGACGG - Intergenic
961385325 3:126520097-126520119 GTTCCCTGGGCAGGTGGGGAGGG - Intergenic
961638437 3:128349598-128349620 GTGGCTTGGGGAGGTGAGGAGGG - Intronic
961788198 3:129360062-129360084 ATTCCTAGGGGAGAAGGGGAAGG - Intergenic
962910873 3:139848472-139848494 GACACCTGGGGACATGGGGAAGG + Intergenic
963067238 3:141273489-141273511 GTGCATTCGGGAGATGGGGTGGG + Intronic
963711329 3:148750952-148750974 GTCCCTGGGGTAGATGAGGAAGG + Intergenic
965586515 3:170323499-170323521 GTCCTTTCGGGAGATGGAGGAGG + Intergenic
966371036 3:179250932-179250954 GTCCTTTGGGGAAAGGGAGAAGG + Exonic
968684012 4:1944102-1944124 GTTCCCTGGGGACATTGGGAAGG + Intronic
969425975 4:7124042-7124064 GCCCATTTTGGAGATGGGGATGG - Intergenic
970813001 4:20117870-20117892 GTATCTTGGGGCGATGGGCAGGG - Intergenic
970845274 4:20530393-20530415 GCTTCTTGGGGAGATGGGGGTGG - Intronic
974835779 4:67249059-67249081 CTCCCTTGGGGAAATGAAGAAGG + Intergenic
975472826 4:74790588-74790610 CTCCTTTGGGCAGATGGAGAAGG - Intronic
976034451 4:80797803-80797825 GAGGCTTGGGGAGATTGGGATGG - Intronic
976116245 4:81730721-81730743 GTCCTTTGCAGAGATGTGGATGG + Intronic
978882242 4:113719669-113719691 GCCCCCTTGGGGGATGGGGAAGG + Intronic
979014733 4:115419072-115419094 GGCCCTTGGGGAGGAGGGGCAGG - Intergenic
979394082 4:120164625-120164647 TTCCCTGGGGGAGATGGAAATGG + Intergenic
980879290 4:138693145-138693167 GTACCAAGGGGGGATGGGGATGG - Intergenic
982604724 4:157499993-157500015 GTCACATGGGGAGATGGGGCGGG + Intergenic
985069013 4:186150245-186150267 GACCCTTGGAGGGAGGGGGAGGG - Intronic
985609951 5:881833-881855 GGCCCTGGGGGAGAGGCGGAAGG + Intronic
985683274 5:1268171-1268193 GGTCCTTGGGGAGATGGGGCTGG - Intronic
986206162 5:5627328-5627350 TTCCTTTGGGTAGTTGGGGAAGG + Intergenic
986670561 5:10139501-10139523 GCCCCTTGGGGAGATGTAGAGGG + Intergenic
986758271 5:10857492-10857514 GTACCTGCGGGAGATGGGAATGG + Intergenic
987353145 5:17039195-17039217 GTCTATTGGGGGGATGGGGAGGG - Intergenic
989551654 5:42742745-42742767 CTCCCTTTGGGAGATGAAGAGGG + Intergenic
992601964 5:78410298-78410320 GGCCTGTCGGGAGATGGGGATGG - Intronic
992911648 5:81401219-81401241 GTCCAGTGGGGAGGTCGGGAGGG - Intergenic
993401002 5:87450944-87450966 GTCTCCTTGGGGGATGGGGATGG + Intergenic
994854286 5:105097324-105097346 GGCTGTTGGGGAGATTGGGATGG + Intergenic
995673373 5:114633471-114633493 GACCCAGGGGGAGGTGGGGATGG - Intergenic
997389919 5:133506034-133506056 GTCTCTTTTGGAGCTGGGGAAGG + Intronic
997523804 5:134539897-134539919 CTCCCCTGGGGAGGTGGGGCTGG + Intronic
998757116 5:145392983-145393005 GTGCAATGGGGAGAAGGGGATGG - Intergenic
999315682 5:150582482-150582504 GGCCTTTGGGGAGCTGGGGTGGG + Intergenic
999331852 5:150678926-150678948 CTCTCTGGGGGCGATGGGGAAGG + Exonic
999604367 5:153297821-153297843 GGACCTTGGGGAGAGGGAGAGGG + Intergenic
1001597547 5:172907730-172907752 GACCTTTGGGGAGAAGGGGCTGG - Intronic
1001731916 5:173966640-173966662 GTCCCTTGAGAATTTGGGGATGG - Intergenic
1001755475 5:174165267-174165289 GTTCCCTGGGGTGCTGGGGAGGG - Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003500908 6:6702073-6702095 GTCCCTCGGGGAGATGGGTGAGG - Intergenic
1004226015 6:13784939-13784961 GGACCTAGGGGAGATGTGGAAGG + Intergenic
1005843658 6:29761183-29761205 GTCCCATGTGGAGATAGGGAAGG - Intergenic
1005994063 6:30921161-30921183 AGCTCTTGTGGAGATGGGGAGGG + Intronic
1006188207 6:32192159-32192181 GTCCCTGGAGGAGGAGGGGATGG + Exonic
1006364923 6:33609747-33609769 GGCCCTTGGGAGGCTGGGGAGGG + Intergenic
1007113574 6:39327827-39327849 ATCGATTGGGCAGATGGGGAGGG - Intergenic
1007266198 6:40598079-40598101 GTCAGTTGTGGGGATGGGGAAGG - Intergenic
1007741484 6:44012562-44012584 GTGACTTGGGCAGATGGAGAGGG - Intergenic
1007742847 6:44023263-44023285 GTTCTTTGGGGACAAGGGGAAGG + Intergenic
1007790678 6:44306529-44306551 CTCCCTGGGGGAGGTGGAGAGGG + Exonic
1007860783 6:44906024-44906046 GTGCGGTGGGGGGATGGGGAGGG + Intronic
1007989416 6:46239659-46239681 GGTCCTTGGTAAGATGGGGAAGG + Intronic
1008625794 6:53315198-53315220 GGGACTTGGGGACATGGGGATGG + Intronic
1010205331 6:73317503-73317525 GTGGCTTGGGGAAAAGGGGAAGG + Intergenic
1012203603 6:96435700-96435722 GTCTCATGGGCAAATGGGGAGGG - Intergenic
1012983876 6:105854902-105854924 GGGCCGTGGGGAGAGGGGGAGGG + Intergenic
1013163238 6:107566373-107566395 CCCCCTTGGGGAGAGGGGAATGG - Intronic
1015227482 6:130873953-130873975 GTCCCTTGGGGAAGTGGGGGTGG + Intronic
1015562954 6:134536365-134536387 GTTGTCTGGGGAGATGGGGAAGG - Intergenic
1017544112 6:155432860-155432882 GTCCCTGGGAAAGATGGGGTTGG + Intronic
1017737234 6:157376289-157376311 GTCTCTCAGGGAAATGGGGATGG - Intergenic
1018474770 6:164129826-164129848 GTCCTTTGGGGAGAAGGCGAAGG + Intergenic
1018722234 6:166581714-166581736 CACCCTGGGCGAGATGGGGAGGG + Intronic
1019127330 6:169849535-169849557 GTCCCTTCAGGAGTTGGGGGAGG + Intergenic
1019168389 6:170114724-170114746 GAACCTTGGGGAGATGGTGGTGG - Intergenic
1019477680 7:1251881-1251903 GTGCCTAGGGGAGCTGGGGGCGG - Intergenic
1019864822 7:3698107-3698129 GTCCTTTGGGAGGAAGGGGAGGG - Intronic
1021081455 7:16370281-16370303 GCCTTGTGGGGAGATGGGGAGGG + Intronic
1021118521 7:16771109-16771131 GTCCCATGAGCAGGTGGGGAAGG - Intronic
1021926706 7:25540802-25540824 TAGCCATGGGGAGATGGGGAGGG + Intergenic
1023852712 7:44159111-44159133 GCCCCTCGGAGAGATGGCGATGG - Exonic
1023931499 7:44709103-44709125 CTCCCCTGAGGGGATGGGGATGG + Intergenic
1024229614 7:47354350-47354372 GTACGTTGGGGAGCTGGGGGTGG - Intronic
1026824512 7:73573124-73573146 GTCCCTAGGGAAGGTGGGGAAGG - Intronic
1026976316 7:74501039-74501061 GACACTTGGGGAGAAGAGGAGGG + Intronic
1028480028 7:91294114-91294136 GTTCCTTGAGGAAATGGGAAAGG + Intergenic
1028674722 7:93445415-93445437 GTCACTTGGGGAGAAGGAGATGG + Intronic
1032020852 7:128406352-128406374 GTGCCCTGGGGAGAAGGGCAAGG - Intronic
1033726743 7:144126862-144126884 GTCCCATTTGGAGGTGGGGAAGG - Intergenic
1035277880 7:157758744-157758766 GTAGCGTGGGGAGCTGGGGAAGG - Intronic
1035888884 8:3323385-3323407 GTGACTTGGGAAAATGGGGAAGG - Intronic
1036444490 8:8809702-8809724 GACAGTTGGGGAGAGGGGGAGGG + Intronic
1036502841 8:9329212-9329234 CTGCCTTGGGGAGCTGGGGAGGG + Intergenic
1036937405 8:13016753-13016775 GTCCTCTGGGGAAAGGGGGAAGG - Intronic
1037929088 8:22866909-22866931 GTCCGGCTGGGAGATGGGGAAGG + Intronic
1038367621 8:26952737-26952759 CTTTCTTAGGGAGATGGGGAGGG + Intergenic
1038981162 8:32761068-32761090 TTCCTTTGGGGAGATTGGGTTGG + Intronic
1039463068 8:37762356-37762378 GTCCCTTGGGGGTGGGGGGACGG + Intergenic
1039917142 8:41868378-41868400 GTCCCCTGGGGCGGTGGGGAAGG + Intronic
1039958037 8:42222064-42222086 CTCCCTTGGGGAGAAGGGAGTGG + Intergenic
1040108006 8:43550903-43550925 GTCCCTCTGGGTGATGGGGCAGG - Intergenic
1041044590 8:53878776-53878798 GGCACTTAGGGAGATGGGAAAGG + Intronic
1041635611 8:60139172-60139194 ATCCCTTGGAGAGTTGGGCAGGG - Intergenic
1041834921 8:62200797-62200819 GTCCATGGTGGAGATGGAGAAGG + Intergenic
1042146979 8:65740162-65740184 GTTGCTTGGGGGGGTGGGGAGGG + Intronic
1043017196 8:74954178-74954200 GTCCTTTGGGGGGAGGGGGGAGG - Intergenic
1045065323 8:98438940-98438962 CACCCGTGGGGAGAAGGGGATGG + Intronic
1046096766 8:109571862-109571884 ATTCCTTGGAGAAATGGGGATGG - Intergenic
1047203581 8:122785770-122785792 GTACCCTGGGGAGGTGGAGAGGG + Intronic
1048018386 8:130517476-130517498 GCCCTTTGGGGAGAGGAGGATGG + Intergenic
1048042127 8:130741120-130741142 TTCCCGTGGGGAGATAGAGAGGG - Intergenic
1048577333 8:135703348-135703370 GTCCTGTAGGGAGATGGGTAAGG + Intergenic
1048767645 8:137862285-137862307 GCCTCTTGGGGAGAGAGGGAGGG + Intergenic
1049156126 8:141067806-141067828 GTCCCTAGGGGAGGAGGGGCAGG + Intergenic
1049520084 8:143083373-143083395 TTCCCTTGGGCAGAGGGGGCTGG - Intergenic
1049576957 8:143393939-143393961 GCCCCCTGGGGAGCTGGGGCAGG + Intergenic
1049607056 8:143534642-143534664 GTCACTTGGGGAGGAGGGGTTGG - Intronic
1049995866 9:1032983-1033005 GTCCTTTGGGGAGCTGAGGCAGG + Intergenic
1050346590 9:4694906-4694928 GACACTTGGGGCCATGGGGAAGG - Intronic
1050438076 9:5629766-5629788 GTCCCTCGGGGAATGGGGGAAGG - Intronic
1052355087 9:27495542-27495564 GTCCCTTGGGGCCATCAGGATGG - Intronic
1052398708 9:27973618-27973640 GTCACTGGATGAGATGGGGATGG + Intronic
1053055638 9:34991721-34991743 GTCTGTGGGGGAGATGGGGTGGG - Intronic
1053284581 9:36842031-36842053 CCTCCTTGGGGTGATGGGGAGGG - Intronic
1055630511 9:78218902-78218924 GTCCCCAGTGGAGATGGGCACGG - Intergenic
1057028729 9:91757113-91757135 GGCCCTGGGGCACATGGGGAAGG + Intronic
1057259994 9:93577689-93577711 CTCCCTAAGGAAGATGGGGAGGG + Intronic
1057539726 9:95955502-95955524 GTTGCTTGGGGATAAGGGGATGG - Intronic
1057915670 9:99053396-99053418 GGACCTTGGGGAGCAGGGGATGG + Intronic
1058070698 9:100598298-100598320 GTGAGTTGGGGAGATGGGGTGGG + Intergenic
1059405634 9:114097174-114097196 ATTCCTGGGGGAGGTGGGGAAGG - Intronic
1059730399 9:117051582-117051604 GTACCTTGGAGAGAAGGGGTGGG - Intronic
1060069946 9:120537399-120537421 GCCCCTTGGGGAGATAGTGGTGG - Intronic
1060219189 9:121755380-121755402 GTCCTTGTGGGAGTTGGGGAGGG + Intronic
1060498151 9:124132985-124133007 GCGCCTTGGAGAGATGTGGAAGG + Intergenic
1060932508 9:127497773-127497795 GGCCCGTGGGGAGAAGGGGCAGG + Intronic
1061068906 9:128296603-128296625 GCCGCTTGGGGAGAGAGGGAAGG + Intergenic
1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG + Exonic
1062273775 9:135721287-135721309 GTCCCTGGGGGTGGTGGGGTAGG + Intronic
1062327442 9:136018983-136019005 GGCTCTTGGGGAGCTGGGCAGGG - Intronic
1186164724 X:6814380-6814402 GGCGATTTGGGAGATGGGGATGG - Intergenic
1187934034 X:24318723-24318745 GTCGCTTCCTGAGATGGGGAAGG - Intergenic
1187944447 X:24412608-24412630 GTGCCTTGGAGAGATTGGGCAGG - Intergenic
1188268396 X:28107449-28107471 GTCCCTTGGGGTGAGGGTGAGGG + Intergenic
1189297616 X:39929963-39929985 GTCCCTAGGGGAGAAGGGTGGGG + Intergenic
1189597396 X:42584033-42584055 GTCCCATGAGGAGATGGAGAGGG - Intergenic
1189864972 X:45318292-45318314 GTGAGTTGGGGAGGTGGGGATGG + Intergenic
1189911027 X:45810674-45810696 GTCTCTTGGGCAGGTGGGGAGGG - Intergenic
1190290614 X:48989707-48989729 GTTCCTAGGAGTGATGGGGAGGG + Exonic
1190723671 X:53172153-53172175 GTGCCCTGGGGAAAGGGGGATGG + Intergenic
1191025250 X:55907524-55907546 ATCCATTTGGGAGATGGTGATGG + Intergenic
1191184006 X:57591465-57591487 GTCCCGCGGGGAGGTGGGAAGGG + Intergenic
1192180003 X:68910499-68910521 GTCTCATGGGGTGATGGGAAAGG + Intergenic
1192433732 X:71129531-71129553 GACCTTTGGGGAGGAGGGGAGGG + Intronic
1195397032 X:104422183-104422205 GGGCCCAGGGGAGATGGGGAAGG + Intergenic
1197287148 X:124609168-124609190 GCCCTTAGGGGAAATGGGGAAGG - Intronic
1197600167 X:128518603-128518625 GTACTCTGGGGAGATGGAGATGG - Intergenic
1199677897 X:150203157-150203179 GTCCCTTGGGGAAGTTGGGAAGG + Intergenic
1200076730 X:153554869-153554891 GCCCTTTGGGGCCATGGGGAAGG + Intronic
1200090182 X:153632384-153632406 GGCCCTGGGTGAGATGGGGCTGG - Intergenic
1200101273 X:153690086-153690108 GTCACTTGGGGCGATGGCCATGG - Intronic
1200110382 X:153737889-153737911 GTCCCTGGGGGTGGTGGGGGTGG + Intronic