ID: 1166828869

View in Genome Browser
Species Human (GRCh38)
Location 19:45626505-45626527
Sequence CTGGAGTTAAGAGGGTGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166828869_1166828876 1 Left 1166828869 19:45626505-45626527 CCCGGTCACCCTCTTAACTCCAG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1166828876 19:45626529-45626551 GTTAAGGTGGATCATCACCATGG 0: 1
1: 0
2: 0
3: 13
4: 195
1166828869_1166828877 6 Left 1166828869 19:45626505-45626527 CCCGGTCACCCTCTTAACTCCAG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1166828877 19:45626534-45626556 GGTGGATCATCACCATGGTATGG 0: 1
1: 0
2: 1
3: 3
4: 61
1166828869_1166828879 21 Left 1166828869 19:45626505-45626527 CCCGGTCACCCTCTTAACTCCAG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1166828879 19:45626549-45626571 TGGTATGGAGAAAGAAACTGAGG 0: 1
1: 0
2: 7
3: 195
4: 2626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166828869 Original CRISPR CTGGAGTTAAGAGGGTGACC GGG (reversed) Intronic
902490755 1:16779044-16779066 CTGGAGTTGAGGGGGTGATGTGG + Intronic
903352118 1:22723553-22723575 CTGGAGTTGAAAGGGTGATGAGG + Intronic
904337151 1:29805319-29805341 CAGGAGGTAACAGGGAGACCTGG + Intergenic
904418457 1:30376695-30376717 CTGGAGTCAAGATGTGGACCTGG + Intergenic
907732451 1:57080324-57080346 GTGGAGTTCAGAGAGAGACCTGG - Intronic
911761076 1:101618080-101618102 CTGAAGTTATCAGGGTAACCTGG + Intergenic
915010332 1:152679388-152679410 GGGGACTCAAGAGGGTGACCAGG - Intergenic
915980589 1:160417464-160417486 CTGGAGGCAAGAAGGTGGCCAGG - Intronic
918681432 1:187359783-187359805 GTAGAGACAAGAGGGTGACCTGG - Intergenic
921774781 1:219084395-219084417 CTGGAGTGAAGTGGGTTAACAGG - Intergenic
923529689 1:234803491-234803513 CTGGAGTTGAGGGGGTGATGTGG - Intergenic
1064870569 10:19932405-19932427 CTGGAGTTATCAGGGTGACAAGG + Intronic
1066477032 10:35757516-35757538 CTGGAGCCAGGAGGGTGACAAGG - Intergenic
1068096893 10:52502670-52502692 CTGGAGTTAAGAGTTTTACCAGG - Intergenic
1074624362 10:115163572-115163594 CTGGAGTTAAGAGACTAGCCAGG - Intronic
1075411823 10:122233970-122233992 CTGGTGCTCAGAGGGTGTCCAGG - Intronic
1076920995 10:133454602-133454624 CTGGAGGTGAGAGGGAGCCCCGG + Intergenic
1077063031 11:626037-626059 CAGGAGCTGAGAGGGTGTCCGGG + Exonic
1077539234 11:3138873-3138895 CTGGAATTAGGAGGATGAGCAGG - Intronic
1078353747 11:10617753-10617775 ATGGAGTTGAGAGGCAGACCAGG - Intronic
1079325414 11:19486971-19486993 CTGGACTTAAGAGGATGATAAGG + Intronic
1080798495 11:35587994-35588016 TTGGGTTTAAGTGGGTGACCTGG - Intergenic
1081961127 11:47138341-47138363 CAGGTGTTGAGAGGGAGACCTGG - Intronic
1083669688 11:64292783-64292805 CTGGAGATAGGAGGGGGACTGGG + Exonic
1084122737 11:67078647-67078669 CTGGAGAGCAGAGGGTGGCCTGG - Intergenic
1084410696 11:69004533-69004555 CTGGAGCCAAGAGGCTGTCCAGG + Exonic
1084483073 11:69433211-69433233 CTGGGGCTCAGAGGGTAACCAGG + Intergenic
1084953218 11:72678057-72678079 GTGGAGTAGAGAGGTTGACCTGG - Intergenic
1085297054 11:75437247-75437269 CTGGAGGTAAGAGGGAGGCCAGG - Intronic
1085978708 11:81694408-81694430 CTGGAGTTCTGAGGTTGAGCTGG + Intergenic
1088586896 11:111367301-111367323 CAAGAGTTAAGAATGTGACCAGG - Intronic
1088894549 11:114067910-114067932 CTGGAGTTTTGAGGGTGAGGGGG - Intronic
1090560813 11:127930018-127930040 CTGGGGTTAAGGGGCTGTCCCGG - Intergenic
1094213971 12:27921306-27921328 CTGGAGATAAGAGTGTGGCAGGG - Intergenic
1098798480 12:74922992-74923014 CTTGAGTTCACAGGCTGACCTGG - Intergenic
1100739936 12:97581076-97581098 ATGGAATTAAGAAGATGACCAGG + Intergenic
1103398035 12:120622987-120623009 CGGGAGTGAAGTGGGTGAGCAGG - Intergenic
1105882304 13:24615473-24615495 GTGGAGTGGAGAGGGTGTCCTGG + Intergenic
1108686901 13:52827521-52827543 TTGGAGATGAGAGGGTGACTAGG - Intergenic
1115044619 14:28976110-28976132 CTGGAGGGAAGAGTGTGGCCTGG + Intergenic
1119141591 14:72272219-72272241 CAGGAGTGAAGAGGGTTAGCTGG + Intronic
1119234119 14:73005363-73005385 CTGGAGTTAAATAGGTTACCTGG + Intronic
1120524507 14:85562215-85562237 ATGGACTAAAGAAGGTGACCAGG - Intronic
1121729039 14:96173697-96173719 CTGCAGCTCAGAGGGAGACCTGG + Intergenic
1122184710 14:99982564-99982586 ATGGGGTTAAGAGGGAGAGCGGG + Intronic
1122298270 14:100717637-100717659 CTTGAGTTAACAAGGAGACCAGG - Intergenic
1122326827 14:100885825-100885847 CTGGCGTTAAGAAGGGGACCTGG - Intergenic
1124963852 15:34418877-34418899 ATGGATCTAAGAGGCTGACCTGG - Intronic
1124980466 15:34565108-34565130 CTGGATCTAAGAGGCTGACCTGG - Intronic
1127491968 15:59473484-59473506 CTGCAGATAAGAGGGTGCCAGGG + Intronic
1128787463 15:70408613-70408635 CTGGAGTTCTGAGGGTGAAAAGG + Intergenic
1129683611 15:77672084-77672106 CTGGAGTTCAGAGAGGGAACTGG - Intronic
1130848028 15:87765719-87765741 CTGTAGTTAAGGTGATGACCAGG - Intergenic
1131723309 15:95195489-95195511 TTTGTGTTAAGAGGGTCACCTGG + Intergenic
1132329696 15:101003790-101003812 CTGGAGCTAAGAGGGTGATATGG - Intronic
1132596294 16:751998-752020 CTGGAGAGAAGAGGCTGCCCTGG - Intronic
1132805852 16:1774776-1774798 CTGGAGTACAGAGGTGGACCAGG + Intronic
1133904185 16:10006147-10006169 CTGCAGTTAGGATGGTGTCCAGG - Intronic
1135997449 16:27262032-27262054 CAGGAGTTAAGAGGCTAGCCTGG + Intronic
1136021702 16:27444673-27444695 CTGGAGTGAATGGAGTGACCCGG + Exonic
1137274816 16:46926489-46926511 CTGTAGTTAAGAGGCTCCCCGGG + Intronic
1137687029 16:50393389-50393411 CTGGGGGTAAGAGGGGGACAAGG - Intergenic
1139968914 16:70761659-70761681 CTGGAGTACAGAGGCTGGCCTGG - Intronic
1142700435 17:1656631-1656653 CTGGAGGTAAGAGGGTGGGGTGG - Exonic
1143258896 17:5583965-5583987 CCGGAGTTAAGAGGGTGTCTGGG + Exonic
1146018179 17:29250105-29250127 CTGAAGTTAAGCTGTTGACCTGG + Intronic
1146261946 17:31427709-31427731 CTGGAGGGTAGAGGGTGCCCTGG + Intronic
1147862790 17:43533349-43533371 CTGGAGTTGAGAAGGAGACAGGG + Intronic
1151439885 17:74121526-74121548 CTGCAGTTGAGATGTTGACCAGG + Intergenic
1152162037 17:78674916-78674938 CTGGAGTGAGGGGGGTGGCCGGG - Exonic
1152210663 17:79001439-79001461 CTGGAGGTAAAATGGTGACAAGG - Intronic
1152799791 17:82325505-82325527 CTGGAGCTGAGCGGGTGGCCGGG - Intronic
1156664306 18:39386690-39386712 CTGGAAGTAAGAGGGTGGCCAGG - Intergenic
1157966325 18:52212333-52212355 TTAGAATTAAGAGAGTGACCTGG + Intergenic
1160598839 18:79997108-79997130 CTGGAGTTAACAGGAAGACTGGG - Intronic
1161150286 19:2703981-2704003 CTGGAGTCCAGAGGATGAGCAGG - Intergenic
1162349606 19:10140681-10140703 CTTGAGTCAGGAAGGTGACCGGG + Intronic
1162934807 19:13976604-13976626 CAGCAGCTAAGAGGGTGACCAGG + Intronic
1166451686 19:42907527-42907549 TTGGAGTTAAGCTGGTGTCCTGG + Intronic
1166454137 19:42926379-42926401 TTGGAGTTAAGCTGGTGTCCTGG + Intronic
1166828869 19:45626505-45626527 CTGGAGTTAAGAGGGTGACCGGG - Intronic
1167615466 19:50530480-50530502 CTGGGTTCAAGAGGGTGAGCAGG - Intronic
925281468 2:2688256-2688278 CTGCAATTAAGACGCTGACCAGG - Intergenic
925416885 2:3676606-3676628 CGGCAGCTAAGAGGGTGGCCTGG - Intronic
926808310 2:16733606-16733628 CTGGAGTGAAGGGGGAGCCCTGG + Intergenic
927653185 2:24924502-24924524 CGGGAGTGGAGAGGGGGACCGGG + Intergenic
928796540 2:35028927-35028949 CATGAGTAAAGAGGCTGACCAGG - Intergenic
930725236 2:54675484-54675506 CTGTAGATAGGAGGGTGACTGGG + Intergenic
932302003 2:70674079-70674101 GTGGAGTAGAGAGGGTGACAGGG + Intronic
937437332 2:121891231-121891253 CTGAAGGGAAGAGGGTGTCCTGG + Intergenic
938044370 2:128104133-128104155 CTGGAGTTATGATGGTGGTCAGG + Intronic
941405163 2:165078379-165078401 CAGGAGATAGGAGGGTGCCCAGG + Intergenic
942799203 2:179857430-179857452 CTGGAGTGCAGAGGGAGATCAGG + Intronic
946305365 2:218853992-218854014 CTGGAGCTCAGAGGGAGGCCTGG - Intergenic
946983592 2:225247087-225247109 CTGGAGTTAAGAGACTGGCCTGG + Intergenic
947527653 2:230889009-230889031 CTGGAGTCAAGCATGTGACCAGG + Intergenic
949005571 2:241645094-241645116 CTGGAGCTGCGAGGGTGTCCAGG + Intronic
949058618 2:241943575-241943597 CAGGAGTTAAGAGGGGGATTGGG + Intergenic
1170693744 20:18638591-18638613 CTGGAGCTTGGAGGGTGACAGGG + Intronic
1171994452 20:31721423-31721445 GTGGAGTCATGGGGGTGACCAGG + Intronic
1172928188 20:38560320-38560342 CTGGTTTTAAGAAGGTGGCCTGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173396265 20:42683078-42683100 ATGCAGTTAAAAGGGTGATCAGG - Intronic
1175399362 20:58692204-58692226 CTGGATGTGAGAGGGTGACAGGG - Intronic
1175545020 20:59772628-59772650 CTGGAGTGAAGAGAGTGAGGTGG + Intronic
1175806607 20:61832716-61832738 CAGGTGTTGAGAGGGAGACCTGG - Intronic
1176135060 20:63518963-63518985 CTAGAGGGAAGCGGGTGACCTGG + Intergenic
1176369367 21:6053158-6053180 CTGGAGCTGAGAGCCTGACCTGG + Intergenic
1178174759 21:30083689-30083711 CTGGAGTTAAGTGGTTGCCACGG + Intergenic
1179036026 21:37759375-37759397 CTGGAGGGAAGAGTGAGACCAGG + Intronic
1179754152 21:43485383-43485405 CTGGAGCTGAGAGCCTGACCTGG - Intergenic
1180231774 21:46430652-46430674 CTGGAGGTAACAGGGTGTCAGGG + Exonic
1180918740 22:19507321-19507343 CTGGAGTTACGAGAGTGCTCAGG + Intronic
1181001573 22:19990169-19990191 CTGCAGCTTAGAGGCTGACCTGG - Intronic
1182353438 22:29711334-29711356 CTGGAGGCCACAGGGTGACCTGG + Intergenic
949191126 3:1250452-1250474 CTGGAGTGAAGAAGGTGTCTTGG + Intronic
950704917 3:14773588-14773610 AGGGAGTTAAGAGGGTGATGGGG + Intergenic
950758469 3:15198384-15198406 CTGGAGTTATGGGGGTGACAAGG - Intergenic
951690227 3:25387367-25387389 CTGTAGGAAAGAGGGTGATCTGG - Intronic
952512137 3:34068521-34068543 CTGGAGCCAAGAGGGTGTTCTGG + Intergenic
954901440 3:54023481-54023503 CTGGGGTTAAGATGGTGTCAAGG + Intergenic
961492211 3:127263874-127263896 CTGGAGGTGAGGGGGGGACCTGG - Intergenic
962362641 3:134754962-134754984 CTGCAGTGAAGAGGGAGCCCAGG - Intronic
967210900 3:187167621-187167643 ATGCAGTTAAGATGTTGACCAGG - Intronic
967508380 3:190280301-190280323 CTGCATTTAAGAGGGTGAGGTGG + Intergenic
967947957 3:194818974-194818996 CTTGAGTTAAGAGGATTTCCCGG + Intergenic
968428001 4:535799-535821 GTGGAGCTGAGAGGATGACCTGG - Intronic
969205208 4:5638757-5638779 CAGGAGATGAGAGGGTTACCAGG + Intronic
971474980 4:27064453-27064475 CAGGAGCTAGGAGGGAGACCTGG - Intergenic
976611675 4:87036879-87036901 CTGGAGTGCAGGGTGTGACCTGG + Intronic
979663728 4:123288001-123288023 CTGGAGTGAAGAGTGTGAGGGGG + Intronic
981634050 4:146854719-146854741 CTGCAGTTAGGAGGGTAAGCTGG - Intronic
984768002 4:183414176-183414198 CTGGAGTTCAGGGGGAGGCCTGG - Intergenic
985647177 5:1090426-1090448 CTGGAGAGGAGAGGGTGACGGGG + Intronic
988521304 5:31947790-31947812 CTGGAGGATAGAGTGTGACCTGG + Intronic
991500309 5:67269795-67269817 CTGCAGATAAGAGGGTGAGACGG - Intergenic
994336172 5:98568833-98568855 CTAGAGCAAAGAGGGTCACCTGG - Intergenic
995527608 5:113063053-113063075 CTGGTGATAAGAGGGAAACCTGG - Intronic
997466795 5:134093634-134093656 CTGGTGTCAAGAGCGTGAGCCGG + Intergenic
998150005 5:139751395-139751417 CTGGGGTTCAGAGAGTGCCCAGG + Intergenic
998403027 5:141857911-141857933 CTGGTGTTTAGAGGCTGAGCTGG - Intronic
998895724 5:146797878-146797900 CTGGAGTTCAGAGGTTGGCAGGG + Intronic
999407878 5:151323369-151323391 ATGGAGTAAAGAGGGTGCCCAGG - Intronic
1000183503 5:158836334-158836356 CTGGACTTCAGAAGGAGACCTGG + Intronic
1001718769 5:173839529-173839551 CTGGAGTTCAGGGAGTGGCCAGG - Intergenic
1002928380 6:1618192-1618214 CTGGGGTTGGGAGGGTGACCTGG + Intergenic
1005401277 6:25436840-25436862 GTGGAGTGGAGAGGGTGAGCTGG + Intronic
1005495357 6:26383395-26383417 CTGGAGAGGAGAGGGGGACCTGG + Intronic
1015754675 6:136595540-136595562 CTGGAGTGAAGAGTGTGAAAAGG + Intronic
1017729841 6:157305649-157305671 CTGATGTTAAGAGGCTGGCCAGG + Intronic
1018171630 6:161147948-161147970 CTGGGGTCAAGAGGGTGATCTGG + Intronic
1019213096 6:170422089-170422111 CTGGACTGAGGAAGGTGACCGGG - Intergenic
1019390598 7:784443-784465 TGGGAGTTAAGAGGGGGTCCAGG - Intronic
1021171405 7:17402192-17402214 CTGGAGTTATGAGGGGGAAGTGG + Intergenic
1021188284 7:17591242-17591264 CTGGAGTTAAGAAAGTCACCTGG + Intergenic
1022500056 7:30877115-30877137 CTGGTGTTAGGAGGGAGCCCAGG + Intronic
1022519382 7:30996182-30996204 CTGGTGTGAAGAGAGTGACCCGG - Intergenic
1029026412 7:97421517-97421539 CTGAGGTTTAAAGGGTGACCAGG - Intergenic
1029466494 7:100728571-100728593 CTGCAGTTAAGATGGAGAGCTGG - Intergenic
1030299024 7:107956730-107956752 CTGGAGCTGAGGGGGTGACAGGG + Intronic
1031981374 7:128127959-128127981 ATGGTATTAAGAGGGGGACCTGG - Intergenic
1032678456 7:134155925-134155947 CTGGAGATTAGAAGATGACCAGG + Intronic
1033059408 7:138091226-138091248 CTGGAGATGTGAGGGTGATCTGG + Intronic
1033351652 7:140567069-140567091 CTGAAGGTAACAGGGTGGCCAGG - Exonic
1034688892 7:152998279-152998301 CTGGAAGTCAGATGGTGACCAGG + Intergenic
1038052890 8:23830002-23830024 CCAGAGTTAACAGGGAGACCAGG - Intergenic
1039392785 8:37195350-37195372 CTGGAGCAAAGAGGGCCACCTGG - Intergenic
1040820047 8:51546455-51546477 CTGGACTCAAGCTGGTGACCAGG - Intronic
1046576807 8:116039847-116039869 CTGGAGTTCAGAGGGTTCCAGGG - Intergenic
1047024884 8:120813529-120813551 CTGCAGGTGAGAGGGTGCCCTGG + Intergenic
1047053154 8:121135985-121136007 CTCAAGTTAAGAGGAGGACCTGG - Intergenic
1048534832 8:135283542-135283564 CAGGAGCTAGGAGGGTGAGCCGG + Intergenic
1052310477 9:27062083-27062105 CTGGAGGTAAGATGGGGTCCAGG - Intronic
1053288482 9:36864808-36864830 CTGGAGTGAGGAGGGTGGGCCGG + Intronic
1055867525 9:80833209-80833231 CTGGAGGAAAGAAGATGACCTGG + Intergenic
1056599214 9:88033009-88033031 ATGGAGGTAAGAGGGTAACAGGG - Intergenic
1060002795 9:119973727-119973749 CTGGAGTTTTGATGATGACCAGG - Intergenic
1060508688 9:124216759-124216781 CTGGGGCTCAGAGGGTGACTTGG + Intergenic
1060536020 9:124388809-124388831 CTGGAGTTTGAAGGGTGACTGGG - Intronic
1062602367 9:137323659-137323681 CTGGAGCTACGGGGGTGTCCAGG - Intronic
1188162463 X:26820268-26820290 CAGGAGTTAAGGGAGAGACCTGG + Intergenic
1189082954 X:37994025-37994047 CTCCAGTTACTAGGGTGACCAGG + Intronic
1191932143 X:66385769-66385791 AAGGAGTTAAGAGGGTTAGCAGG + Intergenic
1194755628 X:97735154-97735176 CTGCAGTTAAGATGTTGGCCCGG - Intergenic
1195341464 X:103910916-103910938 CTGGAGGAAACATGGTGACCAGG + Intergenic
1197100150 X:122643781-122643803 CAGGATTTAGGAGGGTGACTAGG - Intergenic
1199049887 X:143224680-143224702 CTGAAGTTCAGAGGCTGATCTGG + Intergenic
1199551747 X:149068608-149068630 CTTTAGTTAAGTGTGTGACCTGG - Intergenic
1199687848 X:150280291-150280313 CTGGAGATCTGAGGGTGATCTGG + Intergenic
1201231921 Y:11873231-11873253 CAGGTGTTGAGAGAGTGACCTGG - Intergenic
1201693255 Y:16793203-16793225 CTGGAGTTAGGATGGGGACAGGG - Intergenic
1201927185 Y:19300045-19300067 CTGGAGTTAAGGATGTGCCCAGG + Intergenic
1202085769 Y:21135199-21135221 CTGGGGATAAGTGGGTGACAGGG - Intergenic