ID: 1166835304

View in Genome Browser
Species Human (GRCh38)
Location 19:45664093-45664115
Sequence GGCCTGAGGTCACTCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166835304_1166835309 -7 Left 1166835304 19:45664093-45664115 CCTCTGTGGAGTGACCTCAGGCC No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835304_1166835315 27 Left 1166835304 19:45664093-45664115 CCTCTGTGGAGTGACCTCAGGCC No data
Right 1166835315 19:45664143-45664165 TCCAACCTAAACTTCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166835304 Original CRISPR GGCCTGAGGTCACTCCACAG AGG (reversed) Intergenic
No off target data available for this crispr