ID: 1166835308

View in Genome Browser
Species Human (GRCh38)
Location 19:45664107-45664129
Sequence TTGGCCCCAATGAGGGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166835308_1166835318 19 Left 1166835308 19:45664107-45664129 CCTCAGGCCCTCATTGGGGCCAA No data
Right 1166835318 19:45664149-45664171 CTAAACTTCTCCCAAGGTGCTGG No data
1166835308_1166835319 20 Left 1166835308 19:45664107-45664129 CCTCAGGCCCTCATTGGGGCCAA No data
Right 1166835319 19:45664150-45664172 TAAACTTCTCCCAAGGTGCTGGG No data
1166835308_1166835315 13 Left 1166835308 19:45664107-45664129 CCTCAGGCCCTCATTGGGGCCAA No data
Right 1166835315 19:45664143-45664165 TCCAACCTAAACTTCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166835308 Original CRISPR TTGGCCCCAATGAGGGCCTG AGG (reversed) Intergenic
No off target data available for this crispr