ID: 1166835309

View in Genome Browser
Species Human (GRCh38)
Location 19:45664109-45664131
Sequence TCAGGCCCTCATTGGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166835304_1166835309 -7 Left 1166835304 19:45664093-45664115 CCTCTGTGGAGTGACCTCAGGCC No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835297_1166835309 10 Left 1166835297 19:45664076-45664098 CCACCCCTCACTGCCTTCCTCTG No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835296_1166835309 11 Left 1166835296 19:45664075-45664097 CCCACCCCTCACTGCCTTCCTCT No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835295_1166835309 12 Left 1166835295 19:45664074-45664096 CCCCACCCCTCACTGCCTTCCTC No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835294_1166835309 15 Left 1166835294 19:45664071-45664093 CCTCCCCACCCCTCACTGCCTTC No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835292_1166835309 25 Left 1166835292 19:45664061-45664083 CCCTCTACAGCCTCCCCACCCCT No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835300_1166835309 6 Left 1166835300 19:45664080-45664102 CCCTCACTGCCTTCCTCTGTGGA No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835291_1166835309 26 Left 1166835291 19:45664060-45664082 CCCCTCTACAGCCTCCCCACCCC No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835298_1166835309 7 Left 1166835298 19:45664079-45664101 CCCCTCACTGCCTTCCTCTGTGG No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835290_1166835309 27 Left 1166835290 19:45664059-45664081 CCCCCTCTACAGCCTCCCCACCC No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835302_1166835309 -3 Left 1166835302 19:45664089-45664111 CCTTCCTCTGTGGAGTGACCTCA No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835301_1166835309 5 Left 1166835301 19:45664081-45664103 CCTCACTGCCTTCCTCTGTGGAG No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data
1166835293_1166835309 24 Left 1166835293 19:45664062-45664084 CCTCTACAGCCTCCCCACCCCTC No data
Right 1166835309 19:45664109-45664131 TCAGGCCCTCATTGGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166835309 Original CRISPR TCAGGCCCTCATTGGGGCCA AGG Intergenic
No off target data available for this crispr