ID: 1166835312

View in Genome Browser
Species Human (GRCh38)
Location 19:45664126-45664148
Sequence GTTGGAAGGGAGTCTCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166835312_1166835318 0 Left 1166835312 19:45664126-45664148 CCAAGGAGAGACTCCCTTCCAAC No data
Right 1166835318 19:45664149-45664171 CTAAACTTCTCCCAAGGTGCTGG No data
1166835312_1166835315 -6 Left 1166835312 19:45664126-45664148 CCAAGGAGAGACTCCCTTCCAAC No data
Right 1166835315 19:45664143-45664165 TCCAACCTAAACTTCTCCCAAGG No data
1166835312_1166835319 1 Left 1166835312 19:45664126-45664148 CCAAGGAGAGACTCCCTTCCAAC No data
Right 1166835319 19:45664150-45664172 TAAACTTCTCCCAAGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166835312 Original CRISPR GTTGGAAGGGAGTCTCTCCT TGG (reversed) Intergenic
No off target data available for this crispr