ID: 1166835315

View in Genome Browser
Species Human (GRCh38)
Location 19:45664143-45664165
Sequence TCCAACCTAAACTTCTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166835310_1166835315 6 Left 1166835310 19:45664114-45664136 CCCTCATTGGGGCCAAGGAGAGA No data
Right 1166835315 19:45664143-45664165 TCCAACCTAAACTTCTCCCAAGG No data
1166835308_1166835315 13 Left 1166835308 19:45664107-45664129 CCTCAGGCCCTCATTGGGGCCAA No data
Right 1166835315 19:45664143-45664165 TCCAACCTAAACTTCTCCCAAGG No data
1166835304_1166835315 27 Left 1166835304 19:45664093-45664115 CCTCTGTGGAGTGACCTCAGGCC No data
Right 1166835315 19:45664143-45664165 TCCAACCTAAACTTCTCCCAAGG No data
1166835311_1166835315 5 Left 1166835311 19:45664115-45664137 CCTCATTGGGGCCAAGGAGAGAC No data
Right 1166835315 19:45664143-45664165 TCCAACCTAAACTTCTCCCAAGG No data
1166835312_1166835315 -6 Left 1166835312 19:45664126-45664148 CCAAGGAGAGACTCCCTTCCAAC No data
Right 1166835315 19:45664143-45664165 TCCAACCTAAACTTCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166835315 Original CRISPR TCCAACCTAAACTTCTCCCA AGG Intergenic
No off target data available for this crispr