ID: 1166835319

View in Genome Browser
Species Human (GRCh38)
Location 19:45664150-45664172
Sequence TAAACTTCTCCCAAGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166835312_1166835319 1 Left 1166835312 19:45664126-45664148 CCAAGGAGAGACTCCCTTCCAAC No data
Right 1166835319 19:45664150-45664172 TAAACTTCTCCCAAGGTGCTGGG No data
1166835311_1166835319 12 Left 1166835311 19:45664115-45664137 CCTCATTGGGGCCAAGGAGAGAC No data
Right 1166835319 19:45664150-45664172 TAAACTTCTCCCAAGGTGCTGGG No data
1166835308_1166835319 20 Left 1166835308 19:45664107-45664129 CCTCAGGCCCTCATTGGGGCCAA No data
Right 1166835319 19:45664150-45664172 TAAACTTCTCCCAAGGTGCTGGG No data
1166835310_1166835319 13 Left 1166835310 19:45664114-45664136 CCCTCATTGGGGCCAAGGAGAGA No data
Right 1166835319 19:45664150-45664172 TAAACTTCTCCCAAGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166835319 Original CRISPR TAAACTTCTCCCAAGGTGCT GGG Intergenic
No off target data available for this crispr