ID: 1166836071

View in Genome Browser
Species Human (GRCh38)
Location 19:45668861-45668883
Sequence GGGCTTTATCTACCCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166836063_1166836071 21 Left 1166836063 19:45668817-45668839 CCCTAAGTATTTGGATGCTGGGA 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1166836071 19:45668861-45668883 GGGCTTTATCTACCCCCAGCGGG 0: 1
1: 0
2: 0
3: 7
4: 76
1166836064_1166836071 20 Left 1166836064 19:45668818-45668840 CCTAAGTATTTGGATGCTGGGAA 0: 1
1: 0
2: 0
3: 14
4: 194
Right 1166836071 19:45668861-45668883 GGGCTTTATCTACCCCCAGCGGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166836071 Original CRISPR GGGCTTTATCTACCCCCAGC GGG Intronic
900326322 1:2110297-2110319 GGGCTGAATCTGCCTCCAGCGGG + Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905794468 1:40807809-40807831 GGGCTCTGTCTCCCCTCAGCTGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
922619809 1:226982682-226982704 TGCCTTTATCAACCCCCACCTGG + Exonic
923281496 1:232447336-232447358 GTTGTCTATCTACCCCCAGCTGG + Intronic
924259634 1:242216027-242216049 GGGGTTAACATACCCCCAGCGGG + Intronic
1065730972 10:28709314-28709336 TCACTTTATATACCCCCAGCTGG - Intergenic
1065963444 10:30752650-30752672 CGGCATTATCTGGCCCCAGCGGG + Intergenic
1066301254 10:34099396-34099418 GGGATTTATCAAGCCCTAGCTGG - Intergenic
1070918399 10:80169198-80169220 GGGATGTATCCACCCCCAGGAGG - Exonic
1072741657 10:97913663-97913685 GGGCTTTGGGTACCCCTAGCAGG + Intronic
1073352691 10:102831123-102831145 GGGCTGTATCTCTCCCCAGGCGG - Intronic
1075193057 10:120329143-120329165 GGGGTTTATCAACCCCTAACTGG - Intergenic
1082802417 11:57424860-57424882 GAGCTGTATCAGCCCCCAGCAGG + Intronic
1088933374 11:114374895-114374917 GGGCTTTATTTTTTCCCAGCTGG + Intergenic
1089563830 11:119360002-119360024 GTGCTTTACCCACCCCCAGCAGG - Intronic
1090268607 11:125370466-125370488 GGGCTTTATCTTCTCCCACCGGG + Intronic
1099729629 12:86484285-86484307 AAGCTTTAACTAACCCCAGCTGG + Intronic
1100280226 12:93111551-93111573 GGGACTTATCTATCCCCAGTAGG - Intergenic
1103415934 12:120741515-120741537 GGCCTTCATCTGCCCCCAGGTGG - Intergenic
1104674229 12:130701887-130701909 GGGCTGCATGTACCTCCAGCGGG - Intronic
1105730334 13:23208562-23208584 GGGCTCTTTCTAACCCCAGCTGG - Intronic
1111287705 13:86117703-86117725 GGGCTCTCTCAACCCCCACCAGG + Intergenic
1113243879 13:108372557-108372579 GGGATTTATTTACCCCAAGGAGG - Intergenic
1124579121 15:30937115-30937137 GGCCTTTAACTTCCACCAGCTGG - Exonic
1125476062 15:40048761-40048783 GGGGTTTATCCACCCCGACCTGG - Intergenic
1126127607 15:45310122-45310144 GAGCCTTATCTCCCCCCCGCCGG + Intergenic
1131401927 15:92132031-92132053 AGGCTTTCTCAACACCCAGCTGG + Intronic
1132568194 16:632692-632714 GGGCTTTGTGTGCCCACAGCAGG + Exonic
1135064687 16:19299579-19299601 GGGCATTATATTCCCCCTGCTGG + Intronic
1137592165 16:49700384-49700406 GGGCCTTTTCTGCTCCCAGCAGG - Intronic
1146752237 17:35391901-35391923 GGGCTTCCTCTAGCCCCAGCAGG + Intergenic
1150288282 17:63966288-63966310 GGTCCCTATCTGCCCCCAGCTGG - Intronic
1150883414 17:69057768-69057790 GAGCATTATCTACCGCCAGTTGG - Intronic
1153698822 18:7671726-7671748 TGGCTTTCTCTGCCCCCACCTGG - Intronic
1166836071 19:45668861-45668883 GGGCTTTATCTACCCCCAGCGGG + Intronic
926684885 2:15690925-15690947 TGGCTTTATCTCCCACCAGGAGG + Intronic
927155656 2:20219819-20219841 GGGCTGTCCCCACCCCCAGCAGG + Intronic
931286537 2:60836509-60836531 GGGCAAATTCTACCCCCAGCGGG - Intergenic
932402286 2:71489277-71489299 GTGCTTTTTCAACCCACAGCTGG - Intronic
935311520 2:101788344-101788366 GCACTTTATCTACCACCTGCCGG + Intronic
936240165 2:110781105-110781127 GGGCATTCCCTTCCCCCAGCAGG - Intronic
942498069 2:176560236-176560258 TGACTTTATCTTACCCCAGCTGG - Intergenic
943899407 2:193413231-193413253 GTGTTTTATCTACCCCCAATAGG - Intergenic
947040438 2:225912198-225912220 TGGCTTTGTGTTCCCCCAGCAGG - Intergenic
948392750 2:237624727-237624749 GGTCTTTATCTTCCTCCAGGAGG + Intergenic
948770075 2:240247317-240247339 GGGCTTTGTCCACCTCCAGCAGG - Intergenic
948897864 2:240935543-240935565 GGGCCTTCTCTCGCCCCAGCAGG - Intronic
1178234889 21:30829779-30829801 GGGCTTTTTATACCTCAAGCTGG + Intergenic
1183836123 22:40454993-40455015 GGGGTCTATCTTGCCCCAGCTGG + Intronic
1184322456 22:43752886-43752908 CGTCTTTATCTGCCACCAGCTGG - Intronic
953924047 3:46971921-46971943 GGGTTTTATCTGGCCACAGCAGG + Intronic
954375529 3:50192375-50192397 CGGCTTTATCTACTCCCACTGGG - Intronic
956107637 3:65837345-65837367 GTGCTTTATCTTCCGTCAGCAGG - Intronic
960584492 3:119308534-119308556 TGTCTTTCTCTACCCACAGCTGG + Intronic
967768536 3:193309224-193309246 TGCCTTTATCTGGCCCCAGCAGG - Intronic
969511630 4:7621113-7621135 GGACATGACCTACCCCCAGCAGG - Intronic
983273060 4:165586102-165586124 GGGCTTTTTCTCCTCCCAGCTGG + Intergenic
985082965 4:186285046-186285068 GGAATATATATACCCCCAGCTGG - Intronic
985677882 5:1241713-1241735 GGGCTTTGTTCAGCCCCAGCCGG + Intronic
987133504 5:14880744-14880766 GGGCATTTTCTACCCCCATCTGG - Intergenic
987323430 5:16791217-16791239 GGGCATGATCTGCCCCCTGCTGG - Intronic
987939210 5:24510958-24510980 GGACTTTTTATACCCCCAACTGG + Intronic
995303413 5:110613010-110613032 GGCCTTTATCTGCCCATAGCTGG - Intronic
995403046 5:111762935-111762957 GGGCTTTATCCAAACCCAGAAGG + Intronic
997383732 5:133456257-133456279 GGGCTTCATCTCCACCCACCAGG - Intronic
998471515 5:142387333-142387355 TGGCTTTCTCTACCCACAGGAGG - Intergenic
1000024453 5:157346732-157346754 GGGCTGTTTCTGCACCCAGCTGG - Intronic
1013005214 6:106066213-106066235 GGGCTTTATCTTATCCCTGCTGG + Intergenic
1017334306 6:153237222-153237244 GGGCCTTATCTCCGGCCAGCAGG + Intergenic
1019984119 7:4642475-4642497 GGGCTGTGTCCGCCCCCAGCAGG + Intergenic
1022803300 7:33796114-33796136 GGGCTTTATTTGCACCCTGCAGG + Intergenic
1026172104 7:67963017-67963039 GGTCTTTATCTATCCCCAAATGG + Intergenic
1030008115 7:105138379-105138401 GGGCTTCCTGTATCCCCAGCAGG - Intronic
1035051149 7:155999630-155999652 GGCCTCTATCTACCCACACCCGG - Intergenic
1035638020 8:1161797-1161819 GGCCTCTGTCTATCCCCAGCAGG - Intergenic
1039013499 8:33121779-33121801 GGGCTTGATCTACTGCCAGATGG - Intergenic
1053297295 9:36924010-36924032 GGGCTTTACCCACCACCAACAGG + Intronic
1057605774 9:96496883-96496905 GGGCTGTTGCTGCCCCCAGCTGG - Intronic
1058806786 9:108600707-108600729 GGGCTCAATCAACCCCCATCAGG + Intergenic
1060827028 9:126693399-126693421 GGGATGTCCCTACCCCCAGCAGG - Intronic
1188085735 X:25899112-25899134 GGGATTGACATACCCCCAGCAGG + Intergenic
1199719302 X:150530791-150530813 GGACTTTACCAAGCCCCAGCAGG + Intergenic