ID: 1166836630

View in Genome Browser
Species Human (GRCh38)
Location 19:45671227-45671249
Sequence CACTTGGCCCACTGCGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166836628_1166836630 -8 Left 1166836628 19:45671212-45671234 CCCACTGCGCAGTAGCACTTGGC 0: 1
1: 0
2: 1
3: 1
4: 99
Right 1166836630 19:45671227-45671249 CACTTGGCCCACTGCGCAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 94
1166836626_1166836630 13 Left 1166836626 19:45671191-45671213 CCACTGCGGAGAAGCACTTGGCC 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1166836630 19:45671227-45671249 CACTTGGCCCACTGCGCAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 94
1166836625_1166836630 14 Left 1166836625 19:45671190-45671212 CCCACTGCGGAGAAGCACTTGGC 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1166836630 19:45671227-45671249 CACTTGGCCCACTGCGCAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 94
1166836629_1166836630 -9 Left 1166836629 19:45671213-45671235 CCACTGCGCAGTAGCACTTGGCC 0: 1
1: 0
2: 2
3: 7
4: 98
Right 1166836630 19:45671227-45671249 CACTTGGCCCACTGCGCAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166836630 Original CRISPR CACTTGGCCCACTGCGCAGT AGG Intronic
900538992 1:3193483-3193505 CACCCAGCCCACTGAGCAGTGGG - Intronic
901977344 1:13005567-13005589 CACTTCGCCCACTGAGCAACTGG + Intronic
907913261 1:58845634-58845656 TACTTGGCAAACTGAGCAGTGGG + Intergenic
910969671 1:92843529-92843551 CACTTGGAGCACCACGCAGTAGG + Exonic
913161639 1:116150798-116150820 CACTTGGAACAATGCTCAGTGGG + Intergenic
913497646 1:119443134-119443156 CACTTGGCCCAGAGCACAGCAGG - Intergenic
913505344 1:119511759-119511781 CACTTGGCCCAGAGCACAGCAGG - Intronic
914257847 1:145975197-145975219 CATTTGGCCCTCTGCTCAGTGGG + Intronic
915235741 1:154480076-154480098 AACTTGGCCTGCTGTGCAGTGGG - Exonic
916526987 1:165619707-165619729 CACTTGGGCCACAGAGCAGCTGG - Intergenic
922483920 1:225958572-225958594 CTCCAGGCCCACTGCTCAGTCGG - Intergenic
922496440 1:226062028-226062050 CACTTGGCCGAGCGCGCAGGCGG + Intronic
922726397 1:227924945-227924967 CAGGTGGCCCAGTGCCCAGTGGG - Intronic
923535303 1:234845403-234845425 CACTTGGCTGCCTGAGCAGTGGG + Intergenic
923560982 1:235041495-235041517 CACCTTGCCCACTGCCCAGCAGG - Intergenic
1064571668 10:16699743-16699765 CACTTTGCTCACTCCTCAGTTGG + Intronic
1068174951 10:53446398-53446420 CACATGGCCCTCTGTGCACTAGG - Intergenic
1068722458 10:60261297-60261319 CATATGGCCCACTGCACAGCAGG - Intronic
1075770015 10:124925931-124925953 CCCATGGCCTACTGTGCAGTAGG - Intergenic
1076129156 10:128000839-128000861 CACTTGGGCAACTGCCCAGAAGG + Intronic
1076849196 10:133084787-133084809 CACTTGGCCGTCTGCGCTGTAGG + Intronic
1082229866 11:49750639-49750661 CACTTGGCCAACTCCACTGTGGG + Intergenic
1082928636 11:58577912-58577934 CACAAGGCCCACTACTCAGTTGG - Intronic
1085630604 11:78112946-78112968 CACTTTGTCCACTGTCCAGTGGG + Intronic
1087189546 11:95238335-95238357 GAATTGGCCCAGTGGGCAGTGGG + Intergenic
1094216928 12:27952392-27952414 CACTTGGCACATTGCACAGCAGG - Intergenic
1103250334 12:119494476-119494498 CACTGGGCCCACTGTTTAGTGGG + Intronic
1103401383 12:120645437-120645459 CACTTTGTCCACTGTGCAGTGGG - Intronic
1106528777 13:30568130-30568152 CATTTGGCCCACTACACACTAGG - Intronic
1107482745 13:40798519-40798541 CACTTTGCCTAATGCCCAGTGGG - Intronic
1107983096 13:45752145-45752167 CACTGAGGCCACTGAGCAGTTGG + Intergenic
1117301754 14:54437008-54437030 CCCTTGGCACAGTGCTCAGTGGG + Intronic
1119820073 14:77608083-77608105 CACTGGCCCCACTGCCCTGTAGG + Intronic
1120948384 14:90019433-90019455 CATGTGACCCACTGTGCAGTTGG - Intronic
1128139043 15:65286205-65286227 CACTTGGTCCAGGACGCAGTGGG + Intronic
1129451600 15:75654327-75654349 AACCTGTCCCACTGGGCAGTGGG + Intronic
1138082584 16:54104699-54104721 CACTTGGCCAAATGCTGAGTAGG - Intronic
1139307567 16:66000399-66000421 CCCTTTGCCCACTGCCCATTAGG - Intergenic
1142567078 17:847332-847354 CATTTGGCCCAGGGCTCAGTGGG - Intronic
1147489271 17:40849154-40849176 CTCTTGTCCCACTGCTGAGTAGG + Intergenic
1148323495 17:46771059-46771081 CACTCGGCCCACAGCCCAGGAGG - Intronic
1153433640 18:5045740-5045762 GGCTTGGTCCACTGAGCAGTTGG - Intergenic
1157519661 18:48336837-48336859 CACTTGCCCCACTGAGAGGTGGG + Intronic
1161091635 19:2363156-2363178 CATGTGGCCCACTGCGCGCTGGG + Intergenic
1161729435 19:5950220-5950242 CACTTGACCCACAGTGCACTGGG - Intronic
1164579544 19:29425996-29426018 CACCTGGCCACCTGCACAGTGGG + Intergenic
1164594359 19:29524264-29524286 CAGGTGGGCCACTGCGCAGTGGG + Intergenic
1165108537 19:33488183-33488205 CACCTGGCCCACCACGCAGATGG + Intronic
1166030230 19:40119446-40119468 CACTTGGCCTCCTGCGTAGCTGG - Intergenic
1166836630 19:45671227-45671249 CACTTGGCCCACTGCGCAGTAGG + Intronic
1166836631 19:45671234-45671256 CAGTGGACCTACTGCGCAGTGGG - Intronic
926238502 2:11067841-11067863 GGCTTGGCCGACTGCGCAGATGG - Intergenic
928205698 2:29281738-29281760 GACTTGGCCCACTGCCCAGATGG - Intronic
929454044 2:42054066-42054088 CACCTGGCCCACTCCCCACTGGG + Exonic
937425539 2:121795743-121795765 CTCTTGGCCAACTGCCCTGTGGG - Intergenic
938314412 2:130316055-130316077 CACCTGGTCCACTGCACAGGGGG + Intergenic
938802182 2:134773665-134773687 CACTTACCCAACTGCGGAGTGGG - Intergenic
946159987 2:217830186-217830208 CACTTGGCCCACAGAGCCCTGGG - Intronic
946366517 2:219252446-219252468 CTCTTAGCCCACTTCTCAGTGGG + Intronic
1174405377 20:50299427-50299449 CACAGGGGTCACTGCGCAGTAGG + Intergenic
1175263886 20:57691151-57691173 CACTAGGCCCACCACACAGTAGG + Intronic
1175621403 20:60450707-60450729 CACTGGGCACACTGAGCAGTGGG - Intergenic
1176369417 21:6053487-6053509 GACTTTGCCCCCTGCGCACTTGG + Intergenic
1179374742 21:40840540-40840562 CACTTGACCCACTGCACGGCAGG + Intronic
1179555462 21:42172853-42172875 CACTTGGATCACTGCACAGCAGG - Intergenic
1179754102 21:43485054-43485076 GACTTTGCCCCCTGCGCACTTGG - Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1183684159 22:39351788-39351810 CACCTGGCTCACTCCCCAGTGGG - Intronic
1185097790 22:48821192-48821214 CACCTGGCCCACCGCTCACTGGG - Intronic
1185175515 22:49324295-49324317 CACCTGGCCCTCAGCTCAGTAGG + Intergenic
953565660 3:44029648-44029670 CACTTGGCCCCCTGAGTAGGAGG + Intergenic
954682307 3:52352349-52352371 CACTGTGCCCACTGCCCAGTAGG - Intronic
955005707 3:54966433-54966455 CACGTGGCCCACATCACAGTAGG + Intronic
955845804 3:63161541-63161563 CACTTGGCCCTCTGAGTAGGGGG + Intergenic
981366815 4:143913416-143913438 CACTTGGCACAGTGCCCGGTAGG - Intergenic
981376612 4:144023653-144023675 CACTTGGCACAGTGCCCGGTAGG - Intergenic
981387117 4:144144998-144145020 CACTTGGCACAGTGCCCAGTAGG - Intergenic
981747994 4:148069272-148069294 CACCTCGCCCACTGCTCAGCTGG + Intronic
986097997 5:4579543-4579565 CACCTGGCCCTCTGCTCTGTGGG + Intergenic
995216486 5:109601030-109601052 CACTTTTCACACTGGGCAGTTGG + Intergenic
999883308 5:155891196-155891218 CACTTGGCCTCCAGTGCAGTAGG - Intronic
1006212719 6:32411239-32411261 CACTTTGAAGACTGCGCAGTGGG + Intergenic
1009528326 6:64776740-64776762 CACTTGCCACACTGTCCAGTTGG + Intronic
1013595466 6:111656515-111656537 CACTGGCCCCACTGGACAGTGGG + Intergenic
1016092979 6:140001155-140001177 CACTTTGCCAACTGCACATTTGG - Intergenic
1017679039 6:156845292-156845314 CTCCTGGCCCGCTGCGCATTCGG + Intronic
1019207094 6:170370882-170370904 CACTTGGCCCTGTGTGCAGGCGG + Intronic
1019505538 7:1388695-1388717 CACCTGCCCCAGTGTGCAGTAGG + Intergenic
1019842795 7:3465239-3465261 CAGTTGGCCAACTGGGCAGGAGG - Intronic
1030093113 7:105875316-105875338 CATTTGGCCCACTTTGCATTTGG - Intronic
1034953249 7:155315711-155315733 CCCTTGGCTCTCTGGGCAGTAGG + Intergenic
1041296638 8:56363441-56363463 CTCTTGGCCCACTGGGCCTTGGG - Intergenic
1047319178 8:123763405-123763427 CAATTGGACCACTTCCCAGTGGG + Intergenic
1049838240 8:144754156-144754178 CACTTGGCCTGGTTCGCAGTGGG - Intronic
1056563244 9:87751131-87751153 CACTTTGCCCACAGCTCAGTGGG - Intergenic
1056747013 9:89311504-89311526 CACCTGGCGCCCCGCGCAGTCGG + Intronic
1057666295 9:97048202-97048224 CACTTGGCCTAGAGCTCAGTGGG + Intergenic
1057744148 9:97738188-97738210 CACCTGGCCCACTTCACAGACGG + Intergenic
1060375838 9:123114756-123114778 CTCCTGGACCACTGCTCAGTGGG - Intronic
1062269718 9:135702853-135702875 CACTTAGCCCACTTCCCACTGGG - Intronic
1186928737 X:14363712-14363734 CCCTTGACCCACTGGGCAATAGG + Intergenic
1187161518 X:16769483-16769505 CATTTTGCCCACTGCCCAGATGG - Intergenic
1196893128 X:120309408-120309430 TACTTGGCGCACTGCTCTGTGGG - Intronic
1199713469 X:150489126-150489148 CACTTGGCTCACAGATCAGTGGG - Intronic