ID: 1166837850

View in Genome Browser
Species Human (GRCh38)
Location 19:45678099-45678121
Sequence CAGGGGCACCAGCGTCAGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166837850_1166837859 17 Left 1166837850 19:45678099-45678121 CCACGCTGACGCTGGTGCCCCTG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1166837859 19:45678139-45678161 GGTGTTTGCTCCCGTGACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 87
1166837850_1166837853 -7 Left 1166837850 19:45678099-45678121 CCACGCTGACGCTGGTGCCCCTG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1166837853 19:45678115-45678137 GCCCCTGCTGGGTGTCCACGAGG 0: 1
1: 1
2: 1
3: 15
4: 186
1166837850_1166837860 23 Left 1166837850 19:45678099-45678121 CCACGCTGACGCTGGTGCCCCTG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1166837860 19:45678145-45678167 TGCTCCCGTGACAGAGGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 110
1166837850_1166837863 28 Left 1166837850 19:45678099-45678121 CCACGCTGACGCTGGTGCCCCTG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1166837863 19:45678150-45678172 CCGTGACAGAGGAACAGGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 146
1166837850_1166837864 29 Left 1166837850 19:45678099-45678121 CCACGCTGACGCTGGTGCCCCTG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1166837864 19:45678151-45678173 CGTGACAGAGGAACAGGCCCGGG 0: 1
1: 0
2: 1
3: 11
4: 182
1166837850_1166837865 30 Left 1166837850 19:45678099-45678121 CCACGCTGACGCTGGTGCCCCTG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1166837865 19:45678152-45678174 GTGACAGAGGAACAGGCCCGGGG 0: 1
1: 0
2: 0
3: 14
4: 168
1166837850_1166837857 -4 Left 1166837850 19:45678099-45678121 CCACGCTGACGCTGGTGCCCCTG 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1166837857 19:45678118-45678140 CCTGCTGGGTGTCCACGAGGTGG 0: 1
1: 0
2: 0
3: 17
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166837850 Original CRISPR CAGGGGCACCAGCGTCAGCG TGG (reversed) Exonic
900091953 1:924508-924530 CAGCGGCGGCAGCGGCAGCGCGG - Intergenic
900117236 1:1033914-1033936 CAGGGACCCCGGCGTCCGCGGGG - Intronic
902077742 1:13801133-13801155 CAGGGGCATCGACGTGAGCGAGG + Intronic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
904245674 1:29186140-29186162 AAGTGGCACCACCATCAGCGAGG + Intergenic
905172018 1:36115108-36115130 CAGGGGCTCCGGCCTCAGCTGGG + Intronic
912515030 1:110211748-110211770 CAGCGGCAGCAGCGGCGGCGGGG + Exonic
915079843 1:153344683-153344705 CATGGGCTCCAGCCTCAGTGAGG - Intronic
918251713 1:182708848-182708870 TAGGAGCACCAGCGTCAACTTGG - Intergenic
923715911 1:236424758-236424780 CAGGGGCATAAGCTGCAGCGTGG + Intronic
924862186 1:247936521-247936543 GAGGAGCACCAGCGTCCGAGTGG - Intergenic
1065917346 10:30364886-30364908 CAGGGGCACTGGCACCAGCGTGG - Intronic
1066004542 10:31134299-31134321 CAGGGGCTCCATTGTGAGCGGGG - Intergenic
1067941367 10:50659750-50659772 CAGGGGCACCAGCAGGCGCGAGG - Intergenic
1071564080 10:86662620-86662642 CAGGGGCACTAGGGCCAGAGCGG + Intronic
1072632339 10:97155045-97155067 CAGGAGCACCTGCTTCACCGAGG + Intronic
1072794104 10:98341190-98341212 AAAGGGCACCAGCCTCAGCTGGG - Intergenic
1073051528 10:100670441-100670463 TAGGGGCACCAGAGGCAGAGAGG - Intergenic
1073124317 10:101140288-101140310 CAAGGGCAGGAGAGTCAGCGGGG - Intergenic
1073323465 10:102629409-102629431 CAGGGTTACCAGCCTCAGAGTGG - Intronic
1075256095 10:120926899-120926921 CAGAGGAACCAGCCTCAGTGTGG + Intergenic
1075587288 10:123667036-123667058 CAGCAGCACCAGCGTCTGCATGG - Exonic
1076694615 10:132241120-132241142 CAGGAGCACCAGCCACAGCTTGG + Intronic
1076818062 10:132924326-132924348 CAGAGGGCCCAGCGTCAGGGAGG - Intronic
1076904935 10:133356964-133356986 CAGGGGCAGCAGCTTCAGCACGG + Exonic
1077228394 11:1448177-1448199 CAGGGGCAGCAGGGCCACCGAGG - Intronic
1077303294 11:1856829-1856851 CAGGGCCACCTGCCCCAGCGTGG - Intronic
1082238835 11:49851841-49851863 CAGGGAGCGCAGCGTCAGCGCGG - Intergenic
1083602439 11:63957343-63957365 CTGGGGCACCATGGGCAGCGTGG + Intergenic
1084145720 11:67264219-67264241 TAGGGGCACCAGTGACAGTGGGG + Intergenic
1084305122 11:68277578-68277600 CAGTGGCACCAGCGTCCTGGGGG + Intergenic
1084954853 11:72685737-72685759 CAGCTGCAGCAGCTTCAGCGGGG - Intronic
1085205609 11:74730568-74730590 GAGGGGCACCAAGGGCAGCGGGG - Intronic
1085808426 11:79658078-79658100 CAGAAGCATCAGCATCAGCGGGG + Intergenic
1088581749 11:111323305-111323327 CAGTGGCACCAGCATCAACTGGG - Intergenic
1089812507 11:121143481-121143503 CACAGGCACCAGCCTCAGCCTGG - Intronic
1090914832 11:131154240-131154262 CAGCGGCACCAGCAGCACCGGGG - Intergenic
1091610032 12:1999076-1999098 CAGCGGCATCAGCGTCACCTGGG + Intronic
1092589936 12:9943466-9943488 CAGGGGCAGCAACGGCAGCCGGG + Intergenic
1093757166 12:22865722-22865744 CAGGGGCCACAGCGTGAGCAGGG - Intergenic
1096476816 12:51913628-51913650 CAGGGCCACCAGGGCCAGCAAGG - Exonic
1097298971 12:57998031-57998053 CAGGAGGACCAGCTTCAGAGTGG - Intergenic
1102035763 12:109769660-109769682 CAGGCGCACCAGAGTCAGGGTGG + Exonic
1102347204 12:112167844-112167866 CAGCAGCAGCAGCGACAGCGAGG + Exonic
1102430239 12:112877473-112877495 CAGGCACACCAGGGTTAGCGGGG - Intronic
1104372453 12:128235779-128235801 AAGGGGCACCATCGTAAGTGAGG - Intergenic
1104570984 12:129925910-129925932 CAGGGACACCAGCTACAGCATGG + Intergenic
1112504699 13:99968891-99968913 CGGGGGCAGCAGCGTCGGGGTGG - Intronic
1117835587 14:59802274-59802296 CAGCAGCACCAGCATCAGCTGGG + Intronic
1122353646 14:101111343-101111365 CTGGGCCACCAGGGTCAGCCTGG - Intergenic
1122996867 14:105269806-105269828 CTGGGACCCCAGCGTCAGCAAGG - Intronic
1202898152 14_GL000194v1_random:21799-21821 CAGGGGCGCCAGCGTCCCTGGGG + Intergenic
1202898817 14_GL000194v1_random:24397-24419 CAGGGTCACCAGGGTCCACGGGG + Intergenic
1124595260 15:31086602-31086624 CAGGGGCTCCAGGGTCTGAGTGG + Intronic
1125715714 15:41818884-41818906 GAGTTGCGCCAGCGTCAGCGGGG + Exonic
1126419235 15:48454211-48454233 CAGGAGCACCTGCATCAGCTGGG - Intronic
1132500545 16:282905-282927 CAGGGGCAGCAGGGGCAGCAGGG - Exonic
1132500548 16:282914-282936 CAGGGGCAGCAGGGGCAGCAGGG - Exonic
1132546223 16:534579-534601 CAGGGGCCTTAGCGTCAGTGGGG + Intronic
1132685547 16:1160596-1160618 CAGGGACACCAGCGGCCACGTGG - Intronic
1135835796 16:25824127-25824149 CAGGGGCACCTGACTCAGCCAGG - Intronic
1136153104 16:28365006-28365028 CTGGGCCACCCGGGTCAGCGCGG - Intergenic
1136209979 16:28750267-28750289 CTGGGCCACCCGTGTCAGCGCGG + Intergenic
1138426051 16:56932548-56932570 GAGGGGCGCCCGCGTCGGCGGGG - Intronic
1138519535 16:57563225-57563247 CTGGGGCACCCGCTTCAGAGTGG - Exonic
1138521920 16:57575983-57576005 CAGGGGGAAGAGTGTCAGCGTGG + Exonic
1139475250 16:67199659-67199681 GAGGGGCACGAGGCTCAGCGAGG - Intronic
1142059222 16:88019014-88019036 CAGGGGGGCCTGGGTCAGCGTGG - Intronic
1143151428 17:4809426-4809448 CAGGGGCCCCAGGGTCTGAGGGG + Intronic
1147326079 17:39670220-39670242 CACTGGCACCACCGTCAGCCTGG - Exonic
1147690597 17:42312506-42312528 CAAGGGCCCCAGCGACAGCAGGG - Intergenic
1147743840 17:42683325-42683347 CAGGGGCACCAGCTCCTGCTTGG - Intronic
1147995195 17:44356321-44356343 CAGGGGCATCAGCTCCAGCCAGG + Exonic
1152276754 17:79362512-79362534 CAGGGGGAGCAGTGTCAGCAGGG + Intronic
1152429102 17:80237532-80237554 CAGGGGCACCACGGCCAGCCCGG - Exonic
1152634334 17:81424306-81424328 ATGAGGCACCAGGGTCAGCGGGG - Intronic
1152655703 17:81518331-81518353 CAGGGGCACCAGCTTCACTGTGG - Intronic
1152860186 17:82691934-82691956 CAGGGGTACCAGCGTGTGTGAGG + Intronic
1160578250 18:79869214-79869236 CAGGGGCAGGAGACTCAGCGCGG - Intronic
1160749780 19:728276-728298 CGGGGGCAGCAGGGTCAGGGTGG + Intronic
1160804977 19:988673-988695 CAGGGCCTCCAGGGGCAGCGTGG - Intronic
1160954971 19:1686949-1686971 CAGGGGCACGAACATCAGCCTGG - Intergenic
1162944102 19:14031916-14031938 CAGAGGCAGCAGCGCCAGCTTGG - Exonic
1163152942 19:15425473-15425495 CAGGGGCGACAGCGGCAGTGGGG + Exonic
1163715150 19:18868996-18869018 GAGGGTCACCAGCAGCAGCGAGG + Exonic
1165388279 19:35524442-35524464 CAGGGGCACCAGGGCCTGGGAGG + Intronic
1165833033 19:38738504-38738526 CTGGGGCAGCATCGTCAGTGGGG + Intronic
1166310522 19:41959810-41959832 CAGGGGCATCAGCATCACCTGGG - Intergenic
1166837850 19:45678099-45678121 CAGGGGCACCAGCGTCAGCGTGG - Exonic
926125642 2:10270165-10270187 CAGGGGCACCAGGGCAAGCCTGG + Intergenic
926725850 2:15997305-15997327 CAGGGCCACCAGCATCAGGAAGG - Intergenic
926727720 2:16011534-16011556 CAGGAGCACCAGGGACAGGGTGG + Intergenic
927102807 2:19800891-19800913 GAGGAGCACCAGGGTCAGAGAGG + Intergenic
927513520 2:23658917-23658939 CGGAGGCCCCAGCCTCAGCGTGG + Intronic
927785886 2:25974613-25974635 CATGGGCATCAGAGTCAGCCAGG - Intronic
932594684 2:73086681-73086703 CAGGGACACCAGGCTCAGCCTGG + Intronic
932880126 2:75493439-75493461 CAGCGACAGCAGCGACAGCGAGG - Exonic
934777827 2:96950244-96950266 CAGGGGCTGCACCGCCAGCGTGG + Intronic
946302009 2:218829875-218829897 CAGGGGCACCTGGCTCAGCAGGG + Intronic
948100734 2:235370791-235370813 CATGGGCACCCGCGTCACCTGGG + Intergenic
948493238 2:238327302-238327324 CAGGGGCACCTAAGTCAGCCTGG - Intronic
948809353 2:240466863-240466885 GAGGGGCCCCAGCGTCTGCAGGG + Exonic
1168829265 20:835707-835729 CCAGGGCACCAGCGTCTGGGAGG + Intronic
1171027226 20:21641551-21641573 CGGGGGCAGCCGCGTCAGTGTGG + Intergenic
1171795355 20:29561911-29561933 CTGGGGCACCAGGGGCAGCCAGG - Intergenic
1174709265 20:52687420-52687442 CAGGAGCATCAGCATCAGCTGGG - Intergenic
1176081018 20:63273036-63273058 CTGGGGCAGCAGCCTCAGGGTGG - Intronic
1176707100 21:10125098-10125120 CAGGGTCACCAGTGTCCGCGAGG - Intergenic
1179127938 21:38608732-38608754 CAGGGGCACCAGAACCAGTGGGG + Intronic
1180988407 22:19918966-19918988 CGGCGGCACCTGCGTCAACGTGG - Exonic
1182872656 22:33662349-33662371 CAGGAGCCCCAGCATCAGTGAGG + Intronic
1183320948 22:37164712-37164734 CAGAGGCTCCAGCATCACCGAGG + Intronic
1184692878 22:46125301-46125323 CACGGGCCCCAGCCTCAGCAGGG + Intergenic
1185389124 22:50549353-50549375 CAGGGCCACCAGCTTGAGCTGGG - Exonic
950613618 3:14141662-14141684 CACGGTCAGCAGGGTCAGCGAGG - Exonic
952829988 3:37556652-37556674 CAGCAGCACCAGCGTCACCAGGG - Intronic
954686036 3:52370780-52370802 CAGTGGCACCAACGACAGTGAGG + Exonic
955098986 3:55828463-55828485 CAGGGGCAGCAGGGGCAGCAGGG + Intronic
955098989 3:55828472-55828494 CAGGGGCAGCAGGGGCAGCAGGG + Intronic
955510977 3:59679935-59679957 CAGGGGCAGCAGGGGCAGGGAGG - Intergenic
955981243 3:64529742-64529764 CAGGGGCATCAGCATCACCAGGG + Intronic
960965468 3:123101324-123101346 CAGTGGCACCAGCATCATCCAGG - Intronic
962240970 3:133750577-133750599 CAGGGGAACCTGCGCCAGCTGGG - Intronic
964479502 3:157127690-157127712 CAGGGGAGCCAGGGTCAGAGAGG - Intergenic
964819669 3:160755893-160755915 CAGGGGCGCCGGCGCCCGCGCGG - Intronic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968512535 4:1001941-1001963 CAGCACCACCAGGGTCAGCGCGG - Intronic
969671547 4:8592841-8592863 AAGGAGCAGCAGCGGCAGCGGGG - Exonic
971130985 4:23810444-23810466 GAGGGTCACCAGCCTCAGCTTGG - Intronic
973760418 4:54109822-54109844 CGCGGGCACCAGCGTCCGGGCGG + Intronic
975883592 4:78939344-78939366 CCTGGGCAGCAGCGGCAGCGCGG - Exonic
976636620 4:87292678-87292700 CAGGGGGACAAGCGGCAGAGGGG + Intergenic
981615456 4:146639365-146639387 CAGTGGCAGCAGCGGCGGCGGGG + Exonic
985620500 5:952436-952458 CAGGGGCACCAGGTTCAGGGAGG - Intergenic
986988441 5:13524805-13524827 CAGGGGCACTAGCTCCAGGGGGG + Intergenic
994736444 5:103562511-103562533 CAGGGGCTCCCGCGACAGGGCGG - Intronic
998105951 5:139469362-139469384 CAGGGGCTTCAGGGTCAGCCAGG + Intergenic
999525810 5:152404687-152404709 CAGCATCACCACCGTCAGCGTGG - Exonic
1000112602 5:158123227-158123249 CAGGAGCACCAGCATCACCTGGG + Intergenic
1000891856 5:166810554-166810576 GAGAGGCACCAGCGGCAACGGGG - Intergenic
1001034787 5:168290083-168290105 CAGGGACACCAGCCTCAGACTGG - Intergenic
1002026310 5:176398091-176398113 CAGGGGCAGCAGAGACAGCGGGG - Intronic
1007077926 6:39079575-39079597 CAGGGGGATGAGTGTCAGCGTGG - Exonic
1007399939 6:41597867-41597889 CGGGGGCACCCACGTCATCGTGG - Exonic
1014632527 6:123803891-123803913 CAGGGGCAGCAGCGGCAGCCTGG - Intergenic
1017043726 6:150327880-150327902 CAGTGGCACCAGCCTCAGCTGGG - Intergenic
1018363518 6:163096293-163096315 CAGGTGAACCAGCCTCACCGTGG - Intronic
1018823876 6:167394904-167394926 AAGGGGCACCTGCGTCAGGATGG + Intergenic
1018942464 6:168318925-168318947 TAGGGGCAACAGTGTCCGCGTGG - Intronic
1019012450 6:168852596-168852618 CAGGGGCAGCAGAGTCAACAGGG + Intergenic
1019186240 6:170222075-170222097 CAGGTGCATCAGAGTCAGGGTGG - Intergenic
1020853563 7:13388993-13389015 CAGGGGCACCATGATCAGGGTGG - Intergenic
1021901026 7:25285768-25285790 CAGGGGCATCAGCATCACCTAGG - Intergenic
1022230545 7:28409167-28409189 CGGGTGCACCAGGGTCCGCGCGG + Intronic
1023843265 7:44108206-44108228 CAGGGACAGCAGGGACAGCGAGG - Intronic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1026699642 7:72628858-72628880 CACGGCCACCAGAGTCAGCAGGG + Intronic
1029365489 7:100113632-100113654 CAGGGGCACCCGGGGCAGAGGGG + Exonic
1029926833 7:104328112-104328134 CAGAGGCACGAGGGGCAGCGCGG - Intergenic
1033584470 7:142763789-142763811 CAGGGCCACCAGAGTCACCCTGG - Intronic
1034260652 7:149753255-149753277 CAGGGGCAGCAGGGGCAGCAGGG + Intergenic
1034421822 7:150994718-150994740 CAGAGCCACCAGCGGCAGGGAGG - Intronic
1034438312 7:151074205-151074227 CATGAGCACCAGCGACAGCAGGG - Exonic
1036501873 8:9321592-9321614 CAGGAGCACCAGCCTCAGCTCGG - Intergenic
1038156536 8:24996687-24996709 CAGGAGCACCAGCATCAGACTGG - Intergenic
1046187148 8:110735315-110735337 CAGGGATGCCAGCTTCAGCGGGG - Intergenic
1047539063 8:125746448-125746470 CAGAGACACCAGCATCAGCCAGG + Intergenic
1048293875 8:133200273-133200295 CAAGGCCACCAGCTTCAGCATGG + Intronic
1049211112 8:141386875-141386897 CACGGGCACCACCCTCAGCCCGG - Intergenic
1049457309 8:142700324-142700346 CAGGGCCGCCAGCGGCCGCGAGG + Exonic
1050501715 9:6305090-6305112 CAGGGGCTTCAGCGTCAGTCAGG - Intergenic
1053644402 9:40112253-40112275 CAGGGTCCCCAGTGTCCGCGAGG - Intergenic
1053761759 9:41353235-41353257 CAGGGTCGCCAGTGTCCGCGAGG + Intergenic
1054325249 9:63709500-63709522 CAGGGTCGCCAGTGTCCGCGAGG - Intergenic
1054540351 9:66264354-66264376 CAGGGTCGCCAGTGTCCGCGAGG + Intergenic
1056921350 9:90792051-90792073 CAGGGCCAGCAGGGTCAGCAGGG + Intergenic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1057836003 9:98445791-98445813 CAGGGGCACCTGCAGCAGCTGGG + Intronic
1058648931 9:107156955-107156977 CTGGGGCACAAGGGGCAGCGAGG - Intergenic
1060413718 9:123416246-123416268 CAGGAGCACCAGCGTGAAAGAGG - Intronic
1061293681 9:129666089-129666111 CGGGGGCAGCAGCGGCAGCGAGG + Exonic
1202791845 9_KI270719v1_random:93972-93994 CAGGGTCACCAGTGTCCGCGAGG - Intergenic
1187067525 X:15854946-15854968 CAGCGGCACCGGAGGCAGCGCGG + Intronic
1197715704 X:129704730-129704752 CAGTGGCACCACCTTCAGCCAGG - Intergenic
1200236095 X:154468433-154468455 CAGGGCCACCATGGTGAGCGAGG - Exonic
1201151889 Y:11099223-11099245 CAGGGTCACCAGGGTCCACGGGG + Intergenic