ID: 1166837892

View in Genome Browser
Species Human (GRCh38)
Location 19:45678269-45678291
Sequence TTCGTGCCCCTCTGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166837892_1166837899 13 Left 1166837892 19:45678269-45678291 CCTCCTCCCCAGAGGGGCACGAA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1166837899 19:45678305-45678327 CTCTGGTGCAGCCACTGAATGGG 0: 1
1: 1
2: 1
3: 14
4: 150
1166837892_1166837901 17 Left 1166837892 19:45678269-45678291 CCTCCTCCCCAGAGGGGCACGAA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1166837901 19:45678309-45678331 GGTGCAGCCACTGAATGGGGTGG 0: 1
1: 0
2: 3
3: 25
4: 188
1166837892_1166837898 12 Left 1166837892 19:45678269-45678291 CCTCCTCCCCAGAGGGGCACGAA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1166837898 19:45678304-45678326 TCTCTGGTGCAGCCACTGAATGG 0: 1
1: 0
2: 2
3: 18
4: 185
1166837892_1166837905 26 Left 1166837892 19:45678269-45678291 CCTCCTCCCCAGAGGGGCACGAA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1166837905 19:45678318-45678340 ACTGAATGGGGTGGGAAGATGGG 0: 1
1: 0
2: 1
3: 29
4: 325
1166837892_1166837900 14 Left 1166837892 19:45678269-45678291 CCTCCTCCCCAGAGGGGCACGAA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1166837900 19:45678306-45678328 TCTGGTGCAGCCACTGAATGGGG 0: 1
1: 0
2: 0
3: 12
4: 157
1166837892_1166837904 25 Left 1166837892 19:45678269-45678291 CCTCCTCCCCAGAGGGGCACGAA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1166837904 19:45678317-45678339 CACTGAATGGGGTGGGAAGATGG 0: 1
1: 0
2: 1
3: 30
4: 404
1166837892_1166837897 -4 Left 1166837892 19:45678269-45678291 CCTCCTCCCCAGAGGGGCACGAA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1166837897 19:45678288-45678310 CGAAAGCTACAGTCGTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 60
1166837892_1166837902 18 Left 1166837892 19:45678269-45678291 CCTCCTCCCCAGAGGGGCACGAA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1166837902 19:45678310-45678332 GTGCAGCCACTGAATGGGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166837892 Original CRISPR TTCGTGCCCCTCTGGGGAGG AGG (reversed) Intronic
900556508 1:3283463-3283485 TTCTTTCCACTCTGGGGAGTGGG - Intronic
901447416 1:9316789-9316811 TTCGAGCCCAGCTTGGGAGGTGG + Intronic
901652271 1:10749860-10749882 TCGGTGCCCTTCTGGGGAGCAGG - Intronic
902764782 1:18606981-18607003 GCGGTGCCCCTCTGGGGATGGGG - Intergenic
902970593 1:20045302-20045324 TACTTGCCCCCCTGGGGAGGTGG + Intronic
903023643 1:20411667-20411689 TTCCTACCCATCTGGGGAGATGG - Intergenic
904800095 1:33086474-33086496 TTGGTGCGCTTCTGGAGAGGTGG + Intronic
905018033 1:34791020-34791042 TTCTTCATCCTCTGGGGAGGAGG + Intronic
905182346 1:36175149-36175171 TCTGTGCCCCTCGGGGGAGCCGG + Intronic
905560044 1:38919227-38919249 TTCATGTCCTTCTGGGGAGGAGG - Exonic
906378550 1:45316765-45316787 TACTTGCCACTCAGGGGAGGTGG - Intergenic
912643175 1:111366898-111366920 TTCGTGACTCTCTGGGGAATGGG + Intergenic
914428492 1:147599864-147599886 ATCGCGCGCGTCTGGGGAGGGGG + Intronic
915217432 1:154349479-154349501 CTAGGGCCCCTCTGGGGAGTAGG - Exonic
915252305 1:154599404-154599426 TTCCTCCAACTCTGGGGAGGAGG + Intronic
916769145 1:167891285-167891307 CTCCTGCCTCTCTGGGGTGGTGG + Intronic
917908525 1:179614727-179614749 TTTGTGACACTCGGGGGAGGGGG + Intronic
919097934 1:193059566-193059588 TCCTCGCCCCTCTGGGGCGGAGG + Intronic
921937084 1:220805124-220805146 TTCCTGTCCCTGTGGGGTGGAGG + Intronic
922469520 1:225867238-225867260 TTTGTGGAGCTCTGGGGAGGAGG + Intronic
1064183691 10:13141719-13141741 TTCATGCCCATCTGGAGTGGAGG + Intergenic
1070715987 10:78721316-78721338 CTCGTGCCCCTCTGGGATGAGGG + Intergenic
1070812700 10:79306299-79306321 TTGGTGCCCCCTGGGGGAGGCGG - Exonic
1071472189 10:85991513-85991535 GGACTGCCCCTCTGGGGAGGTGG + Intronic
1073341027 10:102744450-102744472 TTCGTGTCCCTCTGTGGAGCAGG + Intronic
1073394409 10:103206344-103206366 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1073683363 10:105728488-105728510 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1076709119 10:132321462-132321484 TTGGGGACCCTCTGGGGAGCTGG - Intronic
1077333838 11:1994679-1994701 TTCGTGCCCCTGTCGGGGTGGGG + Intergenic
1078355240 11:10627874-10627896 TTCGTGACCCACTGGAGATGAGG - Intronic
1079361801 11:19776441-19776463 TTCAAGGCCCTCTGGAGAGGAGG - Intronic
1082870672 11:57941850-57941872 TTTATGACACTCTGGGGAGGGGG + Intergenic
1083164951 11:60878401-60878423 TTCCTGCCCTTTTGGGGAGGTGG + Intergenic
1083848973 11:65354599-65354621 GTCGAGCCCCTCTGGGGGCGGGG - Intergenic
1085311770 11:75521054-75521076 TTCGTGACCCTGGAGGGAGGAGG - Intronic
1086426420 11:86688350-86688372 TTCGGGGCCCTCTGAGGAGGAGG - Intergenic
1090776225 11:129968446-129968468 TGAGTGCCAGTCTGGGGAGGGGG + Intronic
1202816821 11_KI270721v1_random:49861-49883 TTCGTGCCCCTGTCGGGGTGGGG + Intergenic
1095565872 12:43622295-43622317 TTGGTTCCTCTCTGTGGAGGAGG + Intergenic
1095826420 12:46534647-46534669 TTTGTTCCACTCTGGGGAGATGG + Intergenic
1096004882 12:48161464-48161486 TTCCTTTCCCTCTGGGTAGGAGG - Intronic
1099590048 12:84575330-84575352 ATGGTGCCCCTGTGGGGAGGGGG + Intergenic
1100115174 12:91294975-91294997 TTGGTGCCCCTCTGGGATGATGG + Intergenic
1106344857 13:28866102-28866124 TTCGTGCCTCCCTGGGTAGGTGG + Intronic
1109071830 13:57779228-57779250 TTGGTTCCTCTCTGTGGAGGAGG + Intergenic
1109797983 13:67341612-67341634 TTCTTGCCTCTCTAGGCAGGAGG - Intergenic
1112370473 13:98788774-98788796 TTCCTGCCTCACTGGGGAGGGGG - Intergenic
1113916175 13:113875311-113875333 GTGGTGCCCCTCGGGGCAGGCGG - Intergenic
1114458452 14:22872186-22872208 ATGGAGCCCCCCTGGGGAGGCGG + Exonic
1118726182 14:68630615-68630637 TGCCTGCCCATCTGGGCAGGAGG + Intronic
1118751221 14:68808962-68808984 CTGGTGTCCTTCTGGGGAGGGGG - Intergenic
1121124519 14:91397606-91397628 TTCCTGCCGCTCTGGGGTGAGGG + Intronic
1121558183 14:94854365-94854387 TTCATGTCCCCCTGGGGAGATGG - Intergenic
1122078969 14:99253944-99253966 TTCAGGCCTCTCTGGGGATGGGG - Intronic
1122469330 14:101955718-101955740 TGCGTGCCCAGCTGGCGAGGCGG + Intergenic
1122882915 14:104698055-104698077 TTCCTGTGCCTGTGGGGAGGTGG + Intronic
1122953114 14:105056705-105056727 TCTGTGCCCATCTGGTGAGGAGG + Intronic
1126743224 15:51799241-51799263 TTCGTTCCCCTGTGGGATGGTGG + Intronic
1127889312 15:63234743-63234765 TTCCTGCACCTCTGAGGAGAAGG - Intronic
1128452360 15:67813065-67813087 TTCGTCCCGCTTTGGGGAAGAGG + Intergenic
1128461163 15:67868808-67868830 TTCTTGCCCCTCAGGGTATGAGG - Intergenic
1128462927 15:67884804-67884826 TCCGTGCAGCTGTGGGGAGGCGG - Intergenic
1131971042 15:97893089-97893111 TTTGTGCCACTCTGGAGTGGTGG - Intergenic
1132685017 16:1158618-1158640 CTCAGGCCCCGCTGGGGAGGAGG + Intronic
1132725339 16:1335956-1335978 CTCGGGCCGCTCTGGGGATGAGG + Intronic
1133510130 16:6450077-6450099 TTTGTGCCTCTTTGAGGAGGTGG + Intronic
1133943698 16:10331089-10331111 TTCTTGTCCCTCTTGGGTGGTGG + Intronic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1137722110 16:50633445-50633467 TTCTTGCCCCTCTGGCCACGTGG - Exonic
1138415360 16:56868374-56868396 TGAGTGCCCCTCTGGGGAAGAGG + Intronic
1139350160 16:66329827-66329849 TTTGGGTCCCACTGGGGAGGGGG + Intergenic
1139520766 16:67481485-67481507 TCAGTTTCCCTCTGGGGAGGAGG - Intergenic
1140901040 16:79368094-79368116 TTCCTGCCTCTCTGGAGAGCAGG - Intergenic
1143585016 17:7846671-7846693 CTCAGGCCCCTCAGGGGAGGAGG + Exonic
1147264164 17:39225177-39225199 ATCGCGACCTTCTGGGGAGGCGG - Intronic
1147717126 17:42516016-42516038 TGAGTGCTCCTCTGGGGAGAGGG - Intronic
1147919918 17:43909609-43909631 TTCTGGCCCACCTGGGGAGGTGG + Exonic
1148219481 17:45851545-45851567 CTCGTGCTCTTCAGGGGAGGGGG + Intergenic
1149932623 17:60770762-60770784 TTGGTTCCTCTCTGTGGAGGAGG + Intronic
1151214689 17:72569475-72569497 TTCTTCCCGGTCTGGGGAGGGGG - Intergenic
1151786050 17:76275635-76275657 TTTGTGCCCCTTCTGGGAGGTGG - Intronic
1152891386 17:82883557-82883579 TTCCTGCCACTCTGTGGAAGGGG + Intronic
1153240264 18:3025084-3025106 TTCGTGGCCCTCTGGATAAGTGG - Intergenic
1157453865 18:47809142-47809164 CTCGGGCATCTCTGGGGAGGTGG + Exonic
1157490748 18:48122027-48122049 TTCCTGCAGGTCTGGGGAGGAGG + Intronic
1159529082 18:69632535-69632557 TTTGTACCCGTGTGGGGAGGTGG - Intronic
1162003823 19:7764902-7764924 TTCCTGTTCCACTGGGGAGGTGG + Intronic
1163209557 19:15830451-15830473 TTCCTGCTCATCTGGGGAGAGGG - Intergenic
1163289743 19:16371458-16371480 TTAGTGCAACTGTGGGGAGGGGG + Intronic
1166837892 19:45678269-45678291 TTCGTGCCCCTCTGGGGAGGAGG - Intronic
926303394 2:11619383-11619405 TGCGTGAGCCTGTGGGGAGGAGG + Intronic
933723115 2:85410549-85410571 TGTGTGCCCCTCTGAGGAGACGG - Exonic
933999196 2:87692572-87692594 CTCGTGCCTCTCTGGGAAGTGGG - Intergenic
935895553 2:107733765-107733787 TTTGTGCTCCTGTGGAGAGGGGG - Intergenic
940527617 2:154837487-154837509 TTTGTGACCCTCTGGAGTGGTGG + Intronic
943511575 2:188833485-188833507 TTTTTGCCTCTCTGGGCAGGTGG + Intergenic
946384794 2:219376402-219376424 CTCTTGCACCTGTGGGGAGGAGG + Intronic
946756298 2:222951206-222951228 TCCGTGCCACTTTGGGGAGATGG - Intergenic
948836519 2:240628674-240628696 TTTGTGCTCCTCTGGGCAGAGGG + Intronic
948867735 2:240784036-240784058 CCCGTGCTCCCCTGGGGAGGTGG - Intronic
1170012488 20:11741192-11741214 TTTTTGCCCAGCTGGGGAGGAGG - Intergenic
1175479347 20:59300531-59300553 TTCCAGCCCCTCTGGGGGGCGGG + Exonic
1175486996 20:59353809-59353831 TTCTTGCCCCTCTTGAGATGTGG + Intergenic
1175902818 20:62366749-62366771 TTCGCGTCCCTCCGGGAAGGCGG - Intronic
1180000848 21:44994915-44994937 TTCCTTCCCCTCTTGGGAGACGG - Intergenic
1180100385 21:45581242-45581264 CCCGTGCCCCTCTTGGGAGTGGG + Intergenic
1180188615 21:46152184-46152206 TTCAGGGCCCTCTGAGGAGGGGG - Intronic
1180472072 22:15667220-15667242 TTCGTCACTCACTGGGGAGGTGG - Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181500611 22:23313646-23313668 CTTGGGCTCCTCTGGGGAGGGGG + Intronic
1183381503 22:37492593-37492615 TGGGTGCCCCTCTGGGCAGCCGG - Intronic
1185050355 22:48551074-48551096 TCCGTGCCCCTCTGGGGCACGGG + Intronic
1185337110 22:50275635-50275657 TGAGAGCCCCTCAGGGGAGGAGG - Exonic
952773812 3:37025654-37025676 TGCTGGCCCCTCTGGGGAGATGG + Exonic
955176021 3:56613474-56613496 TTGGTTCCCCTCTGTGGAAGAGG + Intronic
966643568 3:182217337-182217359 ATCTTGACCCTCTGGGGAGGAGG + Intergenic
969648375 4:8447607-8447629 TTCCTGAGCCTCTGAGGAGGTGG + Intronic
972192300 4:36609694-36609716 TTCCTTCCCCTCTGTGAAGGTGG - Intergenic
972962508 4:44471553-44471575 TTACTGCCCCACTGAGGAGGTGG + Intergenic
973979581 4:56296764-56296786 TTCCTGCCCCTGTGAGGAGCTGG + Intronic
979361054 4:119765420-119765442 TTCTAGCCCCTTTGGGGTGGTGG - Intergenic
980723639 4:136728604-136728626 TTGGTGTCCTTGTGGGGAGGTGG + Intergenic
980890487 4:138809739-138809761 TTAGTACCCCTCTGGGGCTGGGG - Intergenic
982622890 4:157728500-157728522 TTTGTACCCATCTGGGGAGGGGG - Intergenic
985572172 5:652889-652911 TTCGTGCCCATGCAGGGAGGTGG + Intronic
988685521 5:33521764-33521786 TTCATGCCCCTATGGGAAAGAGG - Intergenic
991037167 5:62138897-62138919 TGTCTGCCCCTCTGGGGAGCCGG + Intergenic
999627308 5:153534327-153534349 TAAATGCCCCTCTGGGGAGAAGG + Intronic
1004455798 6:15790515-15790537 CTCTTGCCCTTCTGGGAAGGAGG + Intergenic
1005912852 6:30326459-30326481 TTCGGGCCAGTCTGGGGAGAGGG - Intronic
1006299517 6:33186140-33186162 TTCCTGCCCCTCCAGGTAGGTGG + Intronic
1007375993 6:41457051-41457073 TGCCTGACCCTCTGGGGAGCTGG - Intergenic
1007660090 6:43478733-43478755 TTAGTGTTCCTCTGGGGATGTGG + Intronic
1010940871 6:81916191-81916213 TTCCTGTTCCCCTGGGGAGGGGG - Intergenic
1013279529 6:108622641-108622663 TTTCTGCCCCTCTAGGGAAGGGG + Intronic
1014794580 6:125710093-125710115 TTTGTGTTCCTGTGGGGAGGAGG - Intergenic
1019028636 6:168992102-168992124 TGCCTGCCCCTCTGAGGATGAGG - Intergenic
1020715675 7:11673015-11673037 TTGGTGCCTCTCTGTGGAAGAGG - Intronic
1021653677 7:22854412-22854434 TTAGGGCCCCTCGGGGGTGGGGG + Intergenic
1024996412 7:55276050-55276072 TGCGTGCCCCACCAGGGAGGTGG + Intergenic
1025907437 7:65798673-65798695 TTTGTGTGCCTCTGTGGAGGGGG + Intergenic
1026910808 7:74090744-74090766 CTCCAGCCCCACTGGGGAGGTGG + Intronic
1029317066 7:99724911-99724933 TTCCTGCTCATCTGGGGAGAGGG - Intronic
1031973396 7:128079285-128079307 TTCCTGCCCATGTGGGGAAGTGG - Intronic
1032184480 7:129712471-129712493 TTTGTGCCCCTCAGGAGAGGGGG + Intronic
1035519523 8:266037-266059 TCAGTGTCCCCCTGGGGAGGGGG + Intergenic
1035519549 8:266102-266124 TCCGTGCCCACCTGAGGAGGGGG + Intergenic
1035519676 8:266430-266452 TCAGTGCCCACCTGGGGAGGGGG + Intergenic
1035773924 8:2172850-2172872 TTCATGTTCCTCTTGGGAGGAGG + Intergenic
1035808311 8:2471687-2471709 GTCGGCCCACTCTGGGGAGGGGG - Intergenic
1036496170 8:9271876-9271898 TACGTCCCCCTCTGAGAAGGGGG - Intergenic
1036668754 8:10765881-10765903 TTCGTTCTCCTCTGGAGTGGAGG + Exonic
1037656529 8:20888566-20888588 TTCGGGCACCTGTGGGGCGGTGG + Intergenic
1038900639 8:31839885-31839907 ATTGTGGCCCTCTGGAGAGGGGG + Intronic
1042397195 8:68306432-68306454 CTCCTGCCACGCTGGGGAGGTGG - Intronic
1043552243 8:81387276-81387298 TTTGTTCCTCTCTGTGGAGGAGG + Intergenic
1044612060 8:94101415-94101437 TTCGTGATCCTCTTGGGAGTTGG + Intergenic
1045347054 8:101302908-101302930 GTCCTGCCCCTCTGGGAAGATGG + Intergenic
1045471192 8:102513845-102513867 TTCGTTACCATCTGGAGAGGTGG + Intergenic
1049280080 8:141739859-141739881 TGTGAGACCCTCTGGGGAGGAGG - Intergenic
1051172905 9:14337634-14337656 TTGGAGCCCCACTGGGGTGGCGG + Intronic
1052143030 9:25011157-25011179 TTGGTGCCCTTCTTTGGAGGTGG - Intergenic
1056034034 9:82584932-82584954 TTAGTGCCACTCTGTAGAGGAGG + Intergenic
1058955524 9:109943331-109943353 TTCCTTCCCTTCTGGGGATGAGG - Exonic
1059322286 9:113479245-113479267 CTTGTGCCCCTCTGGTGATGGGG - Intronic
1060883190 9:127133135-127133157 TCCCTGCCCCTCTGTGAAGGTGG - Intronic
1061809040 9:133151856-133151878 TTCCTGCCCCTCTGCCCAGGAGG + Intergenic
1062039088 9:134395983-134396005 TGCCTGCCCCTGCGGGGAGGCGG + Intronic
1185463161 X:341532-341554 CTCCTGCCTCTCCGGGGAGGAGG + Intronic
1186746266 X:12572837-12572859 TTGGGGCTTCTCTGGGGAGGTGG + Intronic
1197765394 X:130056732-130056754 TTTTTCCCCCACTGGGGAGGGGG + Exonic
1199388025 X:147246025-147246047 GTGGTGGCCCTGTGGGGAGGTGG - Intergenic
1200231225 X:154444772-154444794 TTCGTCTCCCCCTGGAGAGGCGG + Intronic
1200267058 X:154652409-154652431 TTTCTGCCCCTCCGGGGAGGCGG + Exonic