ID: 1166838406

View in Genome Browser
Species Human (GRCh38)
Location 19:45681669-45681691
Sequence CGCGCTGCCGCCAGAGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166838406_1166838417 15 Left 1166838406 19:45681669-45681691 CCCCGCCCTCTGGCGGCAGCGCG 0: 1
1: 0
2: 3
3: 15
4: 133
Right 1166838417 19:45681707-45681729 TCTGAGCGCCATCGTCTCACAGG 0: 1
1: 0
2: 0
3: 1
4: 41
1166838406_1166838419 24 Left 1166838406 19:45681669-45681691 CCCCGCCCTCTGGCGGCAGCGCG 0: 1
1: 0
2: 3
3: 15
4: 133
Right 1166838419 19:45681716-45681738 CATCGTCTCACAGGTGCAGTCGG 0: 1
1: 0
2: 1
3: 10
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166838406 Original CRISPR CGCGCTGCCGCCAGAGGGCG GGG (reversed) Intronic
900135699 1:1116091-1116113 GGCGCCACCGCCTGAGGGCGGGG - Exonic
900188800 1:1344788-1344810 CTAGCTGCCGCCAGGGGGCCAGG + Intronic
1075239001 10:120760312-120760334 TGGGCTGCCGCAAGAGGGCCTGG + Intergenic
1075699831 10:124462044-124462066 CTGGCTGCCGGCAGGGGGCGGGG + Intronic
1075748527 10:124744380-124744402 CGCGCAGCCGCCGATGGGCGGGG + Intronic
1076721664 10:132395964-132395986 CGCGCGGCCGCCGGAGGGCGAGG + Intergenic
1076793842 10:132789478-132789500 AGGGCTGCCCCCAGAGGGCACGG - Intergenic
1076993722 11:288777-288799 CTCGCTGTCGCCCGAGGGCTCGG - Intergenic
1077254188 11:1573117-1573139 CGCGCTGCAGGGGGAGGGCGGGG + Intergenic
1077976261 11:7251854-7251876 CTCGCGGCCGCCGGGGGGCGGGG - Intronic
1081537035 11:44003916-44003938 CTGGCTGCTGCCAGAGGGTGAGG - Intergenic
1083457105 11:62786684-62786706 CCCGCTGCCGCCAGGGGGCGCGG + Exonic
1083777884 11:64903052-64903074 AGCCCTGCCACCAGAGGACGCGG - Intronic
1083958831 11:66002681-66002703 CGCGCTGCGGGGAGGGGGCGGGG + Intronic
1084072365 11:66744750-66744772 CGCGCTGCCGGGCGTGGGCGTGG + Intronic
1085157758 11:74311716-74311738 CGGGCCGGGGCCAGAGGGCGGGG - Intergenic
1091286889 11:134412646-134412668 CGGGCTGCTGCAGGAGGGCGGGG + Intergenic
1092155420 12:6278876-6278898 CGCGTGGCCGCGAGGGGGCGCGG - Intergenic
1096309211 12:50505311-50505333 CGCACGGCCGCCAGAGCGCGCGG - Intronic
1096465689 12:51847022-51847044 CGAGCTGCGGGCAGGGGGCGGGG - Intergenic
1096771760 12:53939723-53939745 CGCGCCGGGGCCAGACGGCGGGG - Intronic
1096955239 12:55518871-55518893 TGCGCTGCCCCCAGAGGTGGAGG - Intergenic
1100260662 12:92929343-92929365 CCCGCGGCCGCCGGGGGGCGGGG + Intergenic
1103562011 12:121797737-121797759 CCCTCTGCCGCCCGAGGGTGTGG - Intronic
1104390567 12:128387969-128387991 AGCTCTGCCACCAGAGGGCGGGG - Intronic
1106602470 13:31199909-31199931 CTCCCGGCCGCCAGAGGGCGCGG + Intergenic
1114070206 14:19099474-19099496 AGCGCTGCCGCCAGAGCTCCAGG - Intergenic
1114092058 14:19300528-19300550 AGCGCTGCCGCCAGAGCTCCAGG + Intergenic
1116003315 14:39267129-39267151 CGGGCAGCCGCGAGAAGGCGGGG - Exonic
1119623707 14:76152232-76152254 CGGGCTGCAGCCTGAGGGCTTGG + Intronic
1121074957 14:91060301-91060323 GGCCCGGCCGGCAGAGGGCGGGG + Intronic
1122883728 14:104701338-104701360 CGAGCTGCAGGCAGAGGGCAGGG - Exonic
1123041112 14:105490589-105490611 AGCGCTGCCGCGGGCGGGCGAGG + Intronic
1125603928 15:40929580-40929602 CGCGCGTCCGCCAGCCGGCGGGG - Exonic
1129188996 15:73926888-73926910 TCAGCTGCCGCCAGCGGGCGGGG - Exonic
1131517427 15:93088669-93088691 CGGGCAGCCGCCAGCGCGCGTGG - Intronic
1132013034 15:98292686-98292708 CGGGAAGCCGCCAGAGGGCTGGG - Intergenic
1132055308 15:98647669-98647691 GCGGCGGCCGCCAGAGGGCGCGG - Intergenic
1132319849 15:100918127-100918149 CGCGGTGGCGCCAGGTGGCGGGG + Intergenic
1132342347 15:101086501-101086523 CGCGCAGGCGCCGGAGGCCGTGG - Intergenic
1132789518 16:1678021-1678043 CGGGCTTCCTCCCGAGGGCGCGG + Intronic
1133423036 16:5663708-5663730 CGCCCTGCTGCCAGTGAGCGTGG + Intergenic
1137665221 16:50245909-50245931 GGCGCTGCCGCGGGAGGGAGCGG - Intergenic
1137730318 16:50684689-50684711 AGCGCTGAAGCCAGATGGCGAGG + Intergenic
1139778282 16:69330597-69330619 CGCGCTGCGGCCGGAAGGGGCGG - Intronic
1142240334 16:88941811-88941833 CGCGCGGCCGCCAGAAGCCGCGG - Intronic
1142518779 17:491123-491145 CTCGGTGCCGCCAGCGCGCGGGG - Intergenic
1143668181 17:8376755-8376777 CGCGGTGCCTCTAGGGGGCGGGG - Intronic
1143965547 17:10754282-10754304 CGTGCTGCCAGCAGAGGGCGTGG + Intergenic
1144775633 17:17783288-17783310 CGCGCTGCCGGCAGAGCCCGAGG + Intronic
1147552633 17:41455175-41455197 CGCTCTGGAGCCAGAGGGCTGGG + Intergenic
1150676092 17:67246271-67246293 CGCGCAGCCGAAAGCGGGCGTGG - Intergenic
1151674127 17:75589218-75589240 GCGGCGGCCGCCAGAGGGCGAGG + Intergenic
1151825712 17:76523146-76523168 CGCGCTGCAGCCTGAGACCGAGG - Intergenic
1152708942 17:81860597-81860619 CGCGCCGCGGCCAGCGCGCGCGG - Exonic
1152738539 17:82009018-82009040 CGGGCTGGAGGCAGAGGGCGCGG - Exonic
1153622191 18:6989772-6989794 GGCACTGCCTCCAGAGTGCGTGG - Intronic
1160619287 18:80159800-80159822 GGCGCTGCCGCCAGGCGGCGTGG - Exonic
1160763505 19:797339-797361 CCCGCTGCAGCCAGGGGGCGGGG - Exonic
1161158704 19:2749388-2749410 CACGGAGCCGCCAGGGGGCGCGG - Intergenic
1161183360 19:2900366-2900388 CGCGCTGCCCCGCGTGGGCGCGG - Intergenic
1162903470 19:13809153-13809175 CCTGCTGCCGCCACAGGGCCAGG - Exonic
1163116442 19:15191719-15191741 GGCACTGCGGCCAGAGGGAGCGG - Intronic
1164855493 19:31517637-31517659 CGGGCTGTGGCCAGAGGCCGCGG + Intergenic
1164872366 19:31656656-31656678 CGCGATGCCGGCAGAAGCCGTGG - Intergenic
1166571344 19:43798887-43798909 CGCGCTGCCGCCAGACTACTCGG - Exonic
1166807587 19:45496631-45496653 CCCGTCGCCGCCAGAGCGCGGGG + Intronic
1166838406 19:45681669-45681691 CGCGCTGCCGCCAGAGGGCGGGG - Intronic
1167258033 19:48442770-48442792 CGCGGGGCCGCCGGGGGGCGCGG + Exonic
1167578322 19:50328299-50328321 CGGGGGGCCGCCAGGGGGCGCGG - Exonic
1168257271 19:55173776-55173798 CTCGCTGCCACCCGAGGGCTCGG + Intronic
927181025 2:20446933-20446955 CCCCCTGCAGCCCGAGGGCGGGG - Intergenic
928181290 2:29070802-29070824 ATCGCTGCCGCCAGAGGCTGGGG - Exonic
930008427 2:46915881-46915903 CCCGCCGCCGCCAGCGGGAGGGG - Intronic
932329359 2:70888969-70888991 CCCGCGGCCGTCAGAGGGCGCGG + Intergenic
936530977 2:113277145-113277167 CCGGCTGCCCCCAGAAGGCGCGG - Intronic
937295587 2:120807988-120808010 GGCCCTGCTGTCAGAGGGCGTGG + Intronic
938133699 2:128737092-128737114 CGCGCGGCCGCCTCCGGGCGGGG + Intergenic
938296431 2:130182226-130182248 GGCGCAGCCGCTAGGGGGCGCGG + Exonic
938843079 2:135181706-135181728 CACGCAGCCGCCAGAGTGCTGGG - Intronic
941929910 2:170929219-170929241 CTCGCTGCCGCCGGAGAGCCGGG - Exonic
942448356 2:176092920-176092942 CGGGCTGCGGGCAGACGGCGGGG + Exonic
945305324 2:208254448-208254470 CTCGCGTCCGCCAGGGGGCGTGG - Intronic
948738230 2:240025126-240025148 GGAGCCGCCGCCAGAGGCCGGGG + Intronic
1168878133 20:1185183-1185205 CGCCCGGCCGCCGGCGGGCGAGG + Intronic
1168913307 20:1467008-1467030 GCCGCGGTCGCCAGAGGGCGCGG - Intronic
1175191775 20:57216487-57216509 GGCGCTGTCTCCTGAGGGCGAGG + Intronic
1175824875 20:61931363-61931385 CGCCCTGCCTGCAGAGGGTGAGG - Intronic
1175847409 20:62065911-62065933 CGCGCGGCCGGCGGGGGGCGGGG + Intergenic
1176304177 21:5114725-5114747 GGTGCTGCCACCAGGGGGCGTGG - Intergenic
1178104142 21:29299289-29299311 CGGGCTGGCGCCCGAGGGCAGGG - Intronic
1178962030 21:37073768-37073790 CACGCAGCCGCCAGGGAGCGCGG - Intronic
1179016672 21:37600022-37600044 CCCGATGCCTCCAGAGGGAGAGG - Intergenic
1179663375 21:42892804-42892826 CGCGTTGCCGACAGAGGGTGAGG + Intronic
1179852879 21:44147305-44147327 GGTGCTGCCACCAGGGGGCGTGG + Intergenic
1180159042 21:45990915-45990937 GGGGCTGCTGCCAGAGGCCGCGG + Intronic
1180488676 22:15822036-15822058 AGCGCTGCCGCCAGAGCTCCAGG - Intergenic
1180908567 22:19432316-19432338 CGCGCTCCCAGCACAGGGCGGGG + Exonic
1181934560 22:26429426-26429448 GACGCCGCCGCCCGAGGGCGCGG - Exonic
1182447281 22:30397214-30397236 CTCGCTGCCGCAGGAGGGCGAGG - Intronic
1183492240 22:38122865-38122887 CCCTCTGTGGCCAGAGGGCGGGG + Intronic
1184771413 22:46598925-46598947 CGCCCTGCACCCAGAGGGCTAGG + Intronic
1185245650 22:49771504-49771526 GGCGCTGCTCCCAGAGCGCGAGG - Intergenic
949342548 3:3045188-3045210 TGCCCTGCCCCCAGAGGGCAAGG - Intronic
950102519 3:10366700-10366722 CGTGGTGCCTCCAGAGGTCGAGG + Intronic
950518049 3:13480226-13480248 AGCTCTGCCCCCAGAGGACGCGG + Exonic
951217559 3:20039964-20039986 CGCTCGCCCGCCAGGGGGCGAGG - Intergenic
951485208 3:23202976-23202998 CGCGCGGCCGCGAGGGGGCGGGG - Intergenic
954540592 3:51391082-51391104 CGCGGTGGCGCCAGAGCGCGCGG + Intergenic
955916398 3:63912351-63912373 CCCGCGGCCGCCCGAGGGAGGGG - Intronic
961692605 3:128680862-128680884 GGCACTGCCGCCAGAGGGCGCGG + Intronic
966912911 3:184569270-184569292 CGCGCTGCCGGCTGGGGACGAGG + Intronic
968286196 3:197510249-197510271 CGCGCTGCCGCCCGAGCCTGAGG - Exonic
968701800 4:2060979-2061001 AGCGCTGGGGGCAGAGGGCGCGG - Exonic
969483130 4:7457426-7457448 TGAGCTGCAGCCAGAGGGCCTGG + Intronic
971244096 4:24912954-24912976 CGCGCGGCCCCGAGAGGGCCCGG + Intronic
971294604 4:25377276-25377298 CGCGCGGCCGGCAGAGGGAGGGG + Exonic
972396520 4:38663732-38663754 CGCGCCGCCGCCCGAGCCCGGGG - Intergenic
976629346 4:87220608-87220630 CGCCCCGCCCCCAGAGGCCGCGG - Exonic
985649370 5:1100203-1100225 CCCGGTGCCGCCCGAGGGTGAGG - Intronic
990041549 5:51383317-51383339 CGCCCTGCAGCCAATGGGCGCGG + Intergenic
991435946 5:66596972-66596994 CGCGCTGCTGCCCCGGGGCGCGG - Exonic
997294755 5:132762437-132762459 GGCCCTGGGGCCAGAGGGCGAGG - Intronic
1001824709 5:174735597-174735619 CGGGCGGCCGGCAGCGGGCGGGG - Intergenic
1003872901 6:10415782-10415804 GGCGCTGCGGCCCGAGGGGGTGG - Intronic
1008952148 6:57172642-57172664 CTCGCTGCCGCCGGAGGGGCCGG + Exonic
1012510292 6:99993902-99993924 CGGGCTGCCGCGCGAGGGCCGGG - Intronic
1015054447 6:128883088-128883110 CGGGCCGCCGCCTGAGGGTGGGG - Intergenic
1019219956 6:170465175-170465197 AGCTCTGCAGCCAGAGGGTGAGG + Intergenic
1019983307 7:4637676-4637698 GGGGATGCCGCCAGAGGGTGTGG + Intergenic
1020117499 7:5484139-5484161 CGAGCTGGAGCCAGAGGGGGTGG - Intronic
1026840570 7:73668186-73668208 CGCGGGGCCGCCCGTGGGCGCGG + Intronic
1034200748 7:149281722-149281744 CCCGCTGCCGCCTGCGGGAGAGG - Exonic
1035729806 8:1845979-1846001 CCAGCTGCACCCAGAGGGCGTGG - Intronic
1036454251 8:8893564-8893586 CGCGCTCCCGCCCGAGCCCGGGG - Exonic
1037337052 8:17801563-17801585 CGGGCTGGCGCCGGGGGGCGTGG - Intergenic
1037886947 8:22600216-22600238 CGCCCCGTCGCCAGAGGGCCTGG + Intronic
1041281141 8:56211714-56211736 CGGGCTGCCGCCGGGGAGCGGGG + Intronic
1045508517 8:102795326-102795348 CCCGCTCCTGCCAGAGCGCGGGG + Intergenic
1048349479 8:133604310-133604332 CGATCTGCTGCCAGAGGGCCAGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1050113812 9:2242585-2242607 CTGGCTGCCGCCAGAGGACCGGG + Intergenic
1053229995 9:36400521-36400543 CGCGCTGCAGCCAACGGCCGCGG + Intronic
1053381200 9:37650884-37650906 CCTGCCGCCGCCAGACGGCGCGG + Intronic
1057741075 9:97711560-97711582 GGCGCTGCCGCCAGAGGAGGGGG + Intergenic
1062398153 9:136360860-136360882 CTCACTGCCTCCAGAGGGCCTGG - Intronic
1187648372 X:21374327-21374349 CGCGCGGCAGCGAGCGGGCGGGG + Intergenic
1200048024 X:153412899-153412921 CCCTCTGCCCCCAGAGGGCAAGG + Intergenic
1200183035 X:154162923-154162945 AGCGCGGCTGCCAGAGGGCCAGG - Intergenic
1200188689 X:154200037-154200059 AGCGCGGCTGCCAGAGGGCCAGG - Intergenic
1200194338 X:154237178-154237200 AGCGCGGCTGCCAGAGGGCCAGG - Intergenic
1200200094 X:154274981-154275003 AGCGCGGCTGCCAGAGGGCCAGG - Intronic