ID: 1166840202

View in Genome Browser
Species Human (GRCh38)
Location 19:45692628-45692650
Sequence CAAGTTCCTCCCCATGGAAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166840202_1166840210 12 Left 1166840202 19:45692628-45692650 CCGATTCCATGGGGAGGAACTTG 0: 1
1: 1
2: 1
3: 5
4: 147
Right 1166840210 19:45692663-45692685 CTCAATCCGTGGTCTGGTACAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1166840202_1166840209 6 Left 1166840202 19:45692628-45692650 CCGATTCCATGGGGAGGAACTTG 0: 1
1: 1
2: 1
3: 5
4: 147
Right 1166840209 19:45692657-45692679 CCTAAACTCAATCCGTGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 35
1166840202_1166840212 19 Left 1166840202 19:45692628-45692650 CCGATTCCATGGGGAGGAACTTG 0: 1
1: 1
2: 1
3: 5
4: 147
Right 1166840212 19:45692670-45692692 CGTGGTCTGGTACAGGTTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 89
1166840202_1166840213 20 Left 1166840202 19:45692628-45692650 CCGATTCCATGGGGAGGAACTTG 0: 1
1: 1
2: 1
3: 5
4: 147
Right 1166840213 19:45692671-45692693 GTGGTCTGGTACAGGTTTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 112
1166840202_1166840207 1 Left 1166840202 19:45692628-45692650 CCGATTCCATGGGGAGGAACTTG 0: 1
1: 1
2: 1
3: 5
4: 147
Right 1166840207 19:45692652-45692674 CTGGGCCTAAACTCAATCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1166840202_1166840214 28 Left 1166840202 19:45692628-45692650 CCGATTCCATGGGGAGGAACTTG 0: 1
1: 1
2: 1
3: 5
4: 147
Right 1166840214 19:45692679-45692701 GTACAGGTTTCAGGGCAAAGCGG 0: 1
1: 0
2: 1
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166840202 Original CRISPR CAAGTTCCTCCCCATGGAAT CGG (reversed) Exonic
900557023 1:3285686-3285708 CAGTTTCCTCCCCCTGGAAATGG + Intronic
901844818 1:11975118-11975140 CAAGTCTCACCCCATGGAAGAGG - Exonic
903604626 1:24566684-24566706 CAAGTGGCTCCCCAGGGAAGAGG + Intronic
906746486 1:48225482-48225504 TAACTTCCTCCTCCTGGAATGGG + Intronic
912052121 1:105542262-105542284 CAAATTTCTCCCCAGAGAATGGG + Intergenic
912700958 1:111877975-111877997 CAAGAACCACCCCATGGAGTTGG + Intronic
914334896 1:146705118-146705140 CAAGTTCAGCCCCATGTCATAGG + Intergenic
917017927 1:170555641-170555663 CAACTTCCTCTTCATGGCATTGG + Intergenic
918806214 1:189049152-189049174 CAAGTTTCTCCCCCTTTAATTGG + Intergenic
920720973 1:208386555-208386577 CAGGTTCCTCCCCAAAGATTGGG + Intergenic
921360735 1:214329246-214329268 CCAGTACCTCCCCATGGGCTGGG + Intronic
921527659 1:216238041-216238063 CAAGACCCTGCCAATGGAATTGG - Intronic
1063679358 10:8172234-8172256 CAAGCTCCCCCACATGGCATTGG - Intergenic
1070179017 10:73997275-73997297 CAATTTCCTACTCATGGACTTGG - Intergenic
1070216603 10:74388952-74388974 CAAGTTCCACACCATGGAGAGGG - Intronic
1070467742 10:76741424-76741446 CATGTACCTGCACATGGAATGGG - Intergenic
1070525574 10:77293159-77293181 CAAACTCCTTCCCATGGCATTGG - Intronic
1070581698 10:77725227-77725249 CCAGTTTCTCCCTTTGGAATGGG + Intergenic
1071038740 10:81280835-81280857 AAAATTCCTCCAGATGGAATAGG - Intergenic
1071651852 10:87399819-87399841 TATGTTCCTCTCCATGGAAGAGG - Intergenic
1079759377 11:24310031-24310053 CAAATTCCTCCCCAGAAAATAGG - Intergenic
1080896661 11:36453880-36453902 CAAGCTCCTCCCCTTGGCCTGGG - Intronic
1084526025 11:69698520-69698542 CACATGCCTCCCCATGGATTGGG - Exonic
1089933434 11:122338238-122338260 AAAGCTCTTCCCCATGGAAGTGG - Intergenic
1091039449 11:132262971-132262993 CAATTTCTCCCCCTTGGAATGGG - Intronic
1092148407 12:6230609-6230631 CCAGTTTCTCCCCATCTAATGGG - Intronic
1094295571 12:28901146-28901168 CAATTTCCTCCCCAGAAAATAGG - Intergenic
1094809970 12:34127014-34127036 CCACTTCCTCCCTATGGGATGGG + Intergenic
1097920386 12:65066204-65066226 CTAATTCCTACCTATGGAATAGG + Intronic
1098298317 12:69027411-69027433 CAACTACCGCTCCATGGAATAGG + Intergenic
1104391852 12:128397584-128397606 CAAGTTGGTCCCCATGGAGGTGG + Intronic
1106802603 13:33271550-33271572 TAAGTTCCTACCTAAGGAATAGG - Intronic
1113547453 13:111165092-111165114 GAAGATCCTCTCCAAGGAATTGG + Intronic
1115918261 14:38342179-38342201 CAAGTTCCAACCACTGGAATGGG - Intergenic
1117584124 14:57182748-57182770 ACAGTTCTTCCCCATGGGATGGG + Intergenic
1120828907 14:88980787-88980809 TATGTTCCTCCCCATTGAAATGG - Intergenic
1122985399 14:105209442-105209464 CCTCATCCTCCCCATGGAATGGG - Exonic
1125858508 15:42974824-42974846 CAAATTCCTCCCAAAGGACTGGG + Intronic
1129239345 15:74242412-74242434 CAATTTCCTCTCTATGTAATAGG + Intronic
1133928813 16:10215599-10215621 CCAGTTCTTCCCCATGCACTAGG - Intergenic
1134194738 16:12150714-12150736 CAACTTCCTCCTCACGGACTTGG - Intronic
1135480686 16:22818324-22818346 CAGCTTCCTCATCATGGAATGGG + Intronic
1135833334 16:25798657-25798679 CAAGTTCATCCACAAGGAAAGGG + Intronic
1139998727 16:71006118-71006140 CAAGTTCAGCCCCATGTCATAGG - Intronic
1141380211 16:83569401-83569423 AAAGTTACTCCCCAAGGAAGGGG - Intronic
1141432246 16:83976243-83976265 CAAGATCCTACCCCTGGATTAGG + Intronic
1144575994 17:16429786-16429808 CAAATCCCTCCCCGTGGAAGGGG - Intronic
1145722032 17:27082600-27082622 CCAGTGCCCCCTCATGGAATAGG - Intergenic
1147855556 17:43477018-43477040 CAAGTCTATCCCCATGGACTTGG - Intergenic
1148145509 17:45362144-45362166 CACGTTCTTGCCAATGGAATGGG - Intergenic
1149039408 17:52170265-52170287 CATTTTCCTTCCCATGAAATGGG + Intergenic
1149369364 17:55977988-55978010 CAATTTCCTCCATTTGGAATGGG - Intergenic
1149654474 17:58302969-58302991 AATCTTCCTCCCCATGGAGTGGG - Intronic
1156737023 18:40272692-40272714 AATATTCCTCCCCATGTAATTGG + Intergenic
1157769641 18:50334579-50334601 CAAGTACCTCTCCATTTAATAGG + Intergenic
1158494139 18:57938346-57938368 CTGGTTCCTCGGCATGGAATTGG - Intergenic
1160705246 19:526482-526504 CCAGTTCCTCACCGTGGAAGAGG - Intergenic
1160837363 19:1131231-1131253 CCAGTGCCTCCCCAGGGAACCGG + Intronic
1163615745 19:18327095-18327117 GAAGTTCCTCACCCTGGACTTGG - Intergenic
1166252470 19:41580842-41580864 CAGGTCCCTCCCCAGGGATTAGG + Intronic
1166840202 19:45692628-45692650 CAAGTTCCTCCCCATGGAATCGG - Exonic
1167709663 19:51102621-51102643 CAGGTTCCTCGCCATGGCCTGGG + Intronic
930307787 2:49697962-49697984 CAATTCCCTCCCTATGAAATGGG - Intergenic
930751784 2:54941605-54941627 GAAGTTCCTCCCCATTTATTGGG - Intronic
934861984 2:97771772-97771794 CCAGTTCCTCCCCATGGAATGGG - Intronic
935354965 2:102189257-102189279 TTTGTTTCTCCCCATGGAATGGG + Exonic
937488714 2:122342610-122342632 GAAGTTCATCTCCATGGAATGGG + Intergenic
939752488 2:146064418-146064440 TGAGTTCCTCCCCAGGAAATGGG + Intergenic
939875980 2:147578237-147578259 CAAGTTCTCCCCCATAGAAAGGG + Intergenic
942209828 2:173659298-173659320 AAATTTCCTCCCCAGGGACTAGG - Intergenic
942488189 2:176461460-176461482 CAAGTTCCGGCCCATGGAGAAGG - Intergenic
943231853 2:185264361-185264383 CAATTTCTTCCACTTGGAATGGG - Intergenic
943796773 2:192006261-192006283 CAAGACCTTCCCCATGTAATGGG - Intronic
948297661 2:236874997-236875019 CAAGTTCTTCCCGCTGTAATTGG + Intergenic
1169338703 20:4779537-4779559 CAAGTTCCACCCTATGGTACGGG - Intergenic
1169412359 20:5382450-5382472 CAAGTTCAGCCCCAGGAAATGGG - Intergenic
1170814158 20:19698589-19698611 CACGTTGCTCCCAATGGAGTTGG - Exonic
1171105372 20:22428254-22428276 CAACTTCCCTCCCATGGAACAGG - Intergenic
1174163470 20:48568099-48568121 CAAGCTCCTCACCATGGCCTTGG - Intergenic
1182279287 22:29208720-29208742 CAAGGTCTTCCCCTTGGAATAGG - Intronic
1182574815 22:31266081-31266103 CCAGGACCTCCCCATGGATTAGG - Exonic
950854304 3:16091168-16091190 CCAGTTCCTCCCCATGGTTAAGG + Intergenic
951398626 3:22202868-22202890 CAAGTTTCAACCAATGGAATGGG - Intronic
952609591 3:35192173-35192195 CAATGTCCTCCCCATGCTATTGG + Intergenic
954090532 3:48280177-48280199 AAAATTCTCCCCCATGGAATTGG - Intronic
956125944 3:66011006-66011028 CAAGTGCCTTCCCAGGGAACTGG + Intronic
959342602 3:105149543-105149565 CAAATTCCTCCCCAGAAAATGGG + Intergenic
962021382 3:131505410-131505432 CAAGGTCCTCCTTATGGACTAGG - Intergenic
962498090 3:135963143-135963165 CAAGTTCCTCACAATGCATTTGG - Intergenic
962502293 3:136007801-136007823 CATCTTCCTCCTCATGGATTTGG + Intronic
964934080 3:162059958-162059980 TAAATTTCTCCCCAAGGAATGGG + Intergenic
965290464 3:166872577-166872599 CTAATTCCTCCCCATAAAATAGG - Intergenic
965854757 3:173074068-173074090 CAATTTCTTCCACTTGGAATGGG + Intronic
965884260 3:173424371-173424393 CAAATTCCTTCCCAGGAAATGGG + Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
968962152 4:3751100-3751122 CAAGGCCCGCCCCATGGGATGGG - Intergenic
970207875 4:13673792-13673814 CAATTTCCTCCCGATGTAATAGG - Intergenic
970234140 4:13941227-13941249 CAAGTGCTTCCTCATGGGATAGG + Intergenic
972894488 4:43602698-43602720 CAATTTCTCCCCTATGGAATGGG + Intergenic
973542345 4:51946898-51946920 CAATTTCCTCCTCTTGGAACAGG + Intergenic
976908206 4:90266759-90266781 CAAGTTCCAACCCCAGGAATGGG - Intronic
977416064 4:96733981-96734003 CCAGTTTCTCCCTTTGGAATGGG + Intergenic
981790110 4:148526815-148526837 CAAGGTCTTCACCATGGACTGGG - Intergenic
985196893 4:187440803-187440825 CATGTTCCTCCTCAGGGAAATGG + Intergenic
991768726 5:70018735-70018757 CAAGTTCTACCCCATAGAAGAGG - Intergenic
991847964 5:70893812-70893834 CAAGTTCTACCCCATAGAAGAGG - Intergenic
994412934 5:99432132-99432154 CATCCTCCTTCCCATGGAATGGG - Intergenic
994614658 5:102089354-102089376 CAAGTTCCAACCACTGGAATTGG + Intergenic
995989358 5:118217595-118217617 CTAGTTTCTCACCATGAAATAGG - Intergenic
996833526 5:127766399-127766421 CAATTTCCTCCCTAAGGAACTGG + Intergenic
999906350 5:156144786-156144808 CAATTTCTTCCTTATGGAATGGG + Intronic
1002887345 6:1309454-1309476 CAATGTACTCCCCAAGGAATGGG + Intergenic
1003099252 6:3164520-3164542 CAAGTTCCTCCCAAGGAAACTGG - Intergenic
1003536705 6:6981841-6981863 CAAGTTCCCCATCATGGAACTGG - Intergenic
1007984115 6:46190128-46190150 CCATTTCCTGCCAATGGAATGGG - Intergenic
1010644669 6:78372903-78372925 CAAGTTCCAACCCCTGGAAAGGG - Intergenic
1010893372 6:81339810-81339832 CAGGTTTCTCCCCATTGAAGAGG - Intergenic
1011879122 6:92001530-92001552 CAGGTCCCTCCCCAAGGACTGGG - Intergenic
1012078594 6:94727208-94727230 CAATTTCTTCCACTTGGAATTGG - Intergenic
1013324217 6:109028238-109028260 CAAGTTTCTCTTCAGGGAATGGG + Intronic
1017223226 6:151990577-151990599 CTAGTTCTTCCCCATGGAATGGG - Intronic
1017787184 6:157766206-157766228 CAAGTTCATCCCTTTGAAATGGG - Intronic
1020173177 7:5861439-5861461 CAACTTCCTCCCCAAGAACTGGG - Intergenic
1022205122 7:28156331-28156353 GAAGTGACTCCCCATGCAATTGG - Intronic
1022749972 7:33214151-33214173 CAAGTTCCTACCATTGGGATGGG + Intronic
1023602831 7:41897311-41897333 ATAGTTCATCCCCATGGAGTTGG + Intergenic
1027994790 7:85412022-85412044 CAATTTCCTCACCTTTGAATTGG - Intergenic
1030432475 7:109468367-109468389 CAATTTGCTCTCCAGGGAATAGG + Intergenic
1030527561 7:110672649-110672671 CCAGTTTCTCCCATTGGAATGGG - Intronic
1030636071 7:111950478-111950500 CTAGTTGCTCACCATGTAATAGG - Intronic
1034520371 7:151614710-151614732 CCAGTTCAGCACCATGGAATGGG + Intronic
1035180414 7:157085243-157085265 CAATTTCTTCCCTTTGGAATGGG + Intergenic
1035783639 8:2247328-2247350 CTGGTTCCTCCTCTTGGAATTGG - Intergenic
1035808475 8:2472220-2472242 CTGGTTCCTCCTCTTGGAATTGG + Intergenic
1037457528 8:19078809-19078831 CAAATTCCTCCCTGTGGAGTAGG + Intronic
1037787088 8:21909608-21909630 GAAGTTCTTCCCCAAGGAACGGG + Exonic
1038707590 8:29909486-29909508 CTGGTTCCTCTCCATGGAAGAGG - Intergenic
1048478832 8:134769317-134769339 CAATTTCCCCCACTTGGAATGGG - Intergenic
1051572174 9:18571568-18571590 CAAGTTCCTGGTCATTGAATGGG - Intronic
1052356664 9:27511967-27511989 TAAGTTCCAGCCAATGGAATGGG + Intronic
1055000699 9:71446568-71446590 CAAGTTCAGCACCATGGAAAGGG + Intronic
1056769355 9:89465693-89465715 CAATTGACTCCCCATGGAAAAGG - Intronic
1057202399 9:93148913-93148935 CGAGTTCCTCCCCAAGGGATTGG - Intergenic
1058772769 9:108253520-108253542 AAAGCTCATCCACATGGAATAGG - Intergenic
1059802810 9:117767846-117767868 CAAGTTCCTCCCTGTAAAATGGG + Intergenic
1059972328 9:119680528-119680550 AAAGCCCCTTCCCATGGAATTGG - Intergenic
1060582624 9:124764870-124764892 CATGTTGCTGCCCAGGGAATTGG + Intronic
1061447770 9:130650983-130651005 AAAGCTCTTCCCCCTGGAATGGG - Intergenic
1061715449 9:132515777-132515799 AAAGTTCCTCACCATGGAAATGG - Intronic
1188731093 X:33647523-33647545 CAATTTCTTCCACTTGGAATGGG - Intergenic
1191034800 X:56013265-56013287 CAATTTCTTCCACTTGGAATTGG + Intergenic
1193270073 X:79518216-79518238 CAAGTTGCTCTCCTTTGAATGGG - Intergenic
1198718773 X:139592554-139592576 AAAGTACCTTCCCAAGGAATAGG + Intronic
1199133202 X:144219268-144219290 CAAGTTCCACCCGCTGGGATAGG + Intergenic
1199196851 X:145041881-145041903 CAAGGTCTTGCCCATGAAATGGG + Intergenic