ID: 1166842914

View in Genome Browser
Species Human (GRCh38)
Location 19:45709875-45709897
Sequence GTGTAGTGCTTCTGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166842907_1166842914 23 Left 1166842907 19:45709829-45709851 CCCTTCTGTGGCTAAGTCTGACG No data
Right 1166842914 19:45709875-45709897 GTGTAGTGCTTCTGGGAGGAAGG No data
1166842908_1166842914 22 Left 1166842908 19:45709830-45709852 CCTTCTGTGGCTAAGTCTGACGG No data
Right 1166842914 19:45709875-45709897 GTGTAGTGCTTCTGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166842914 Original CRISPR GTGTAGTGCTTCTGGGAGGA AGG Intergenic
No off target data available for this crispr