ID: 1166844302

View in Genome Browser
Species Human (GRCh38)
Location 19:45717457-45717479
Sequence TGCCCATATAAGGCAGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166844298_1166844302 -10 Left 1166844298 19:45717444-45717466 CCATTCGGGGCCGTGCCCATATA 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1166844302 19:45717457-45717479 TGCCCATATAAGGCAGGCCTTGG 0: 1
1: 0
2: 1
3: 7
4: 154
1166844297_1166844302 -7 Left 1166844297 19:45717441-45717463 CCGCCATTCGGGGCCGTGCCCAT 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1166844302 19:45717457-45717479 TGCCCATATAAGGCAGGCCTTGG 0: 1
1: 0
2: 1
3: 7
4: 154
1166844294_1166844302 4 Left 1166844294 19:45717430-45717452 CCAATGAGCGGCCGCCATTCGGG 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1166844302 19:45717457-45717479 TGCCCATATAAGGCAGGCCTTGG 0: 1
1: 0
2: 1
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166844302 Original CRISPR TGCCCATATAAGGCAGGCCT TGG Intronic
901451483 1:9339102-9339124 AGCCCAGGCAAGGCAGGCCTGGG + Intronic
902673478 1:17992269-17992291 AGCCCATGAGAGGCAGGCCTGGG + Intergenic
903483423 1:23671163-23671185 TGCCCATCTCAGGCTGGCATGGG + Intergenic
906294759 1:44642777-44642799 TCCACTTATAAGGCAGGGCTAGG + Intronic
906376251 1:45299166-45299188 TGCCCATCACAGTCAGGCCTTGG + Intronic
907323106 1:53618091-53618113 AGCCCAGAAAGGGCAGGCCTGGG + Intronic
909520503 1:76562937-76562959 TGCACATAGAAGGAAGGCATAGG + Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
915688653 1:157663591-157663613 AGCTCTTATAAGGCAGGCCTGGG - Intergenic
917908432 1:179613679-179613701 TGCCCCTATTAGAGAGGCCTTGG - Intronic
918107091 1:181424752-181424774 TTCCCTTCTAAGGCAGGCCTTGG + Intronic
923249854 1:232169657-232169679 TGCCCATACATGCCAGGCATGGG - Intergenic
923934754 1:238748074-238748096 TGCCCCTATAAGAAATGCCTGGG + Intergenic
1068126203 10:52845088-52845110 AGCTCTTGTAAGGCAGGCCTGGG + Intergenic
1068964297 10:62896198-62896220 AGCCTATAAGAGGCAGGCCTAGG - Intronic
1070072184 10:73100619-73100641 TGCCCATATAAGCCAGACTATGG + Intergenic
1070919905 10:80178088-80178110 AGCCCAGATATGGCAGCCCTGGG - Intronic
1074062912 10:109984252-109984274 TGCCCATCTTTGGCATGCCTTGG - Intergenic
1074744252 10:116515470-116515492 TGCCCTTATAAATGAGGCCTGGG + Intergenic
1074934663 10:118165997-118166019 TGCCCATCAAATGCAGGACTGGG - Intergenic
1075429736 10:122370338-122370360 TGACCACATGTGGCAGGCCTGGG - Intergenic
1079265079 11:18923073-18923095 AGCTCTTGTAAGGCAGGCCTGGG - Intergenic
1081425082 11:42917524-42917546 AGCTCTTGTAAGGCAGGCCTGGG - Intergenic
1081625674 11:44653815-44653837 GACCCATTTATGGCAGGCCTTGG + Intergenic
1084155191 11:67309360-67309382 TGCCCACATCAGCCTGGCCTTGG + Intronic
1085024665 11:73229513-73229535 TGTCCCTCTAAGGCAGGGCTAGG + Intronic
1085123481 11:73982146-73982168 TCCCCATCCAAGGCAGGGCTCGG + Intronic
1088427744 11:109723478-109723500 TGCCCTTATAAAGGAGGCCTGGG - Intergenic
1089300593 11:117496414-117496436 TGCCCACTTAGGGCAGGGCTTGG + Intronic
1089575329 11:119438297-119438319 TGCCCTTATAAAAGAGGCCTCGG - Intergenic
1089828175 11:121298352-121298374 TGCACAGTTAAGGGAGGCCTAGG + Intronic
1090095368 11:123737700-123737722 TGGTTATATATGGCAGGCCTAGG + Intronic
1092051303 12:5472593-5472615 TCCCCACTTAAGGCAGGCCCAGG - Intronic
1092792527 12:12082262-12082284 TGCCCAGCTAGGGCAGGTCTAGG + Intronic
1095310377 12:40691604-40691626 TTCACATAAAAGGCAGGCTTGGG + Intergenic
1095572662 12:43700638-43700660 TGGCCATATCGGGCAGGCCCAGG + Intergenic
1099890575 12:88584552-88584574 TGCCCATATAAGCCAGGAATTGG + Intergenic
1101205832 12:102486409-102486431 GGCCCACAAGAGGCAGGCCTGGG + Intergenic
1104048206 12:125178338-125178360 TGCACATGTAACTCAGGCCTGGG + Intergenic
1107826550 13:44333551-44333573 TGCCCATATAAAGCTGACCACGG + Intergenic
1109042210 13:57354020-57354042 TGTCCATATAAAAGAGGCCTTGG + Intergenic
1110707592 13:78612611-78612633 TGCCCTTATAAAAAAGGCCTGGG - Intergenic
1112890387 13:104222283-104222305 TCCCCATAAAAGGCAGGACCAGG - Intergenic
1113321447 13:109236243-109236265 TGCCCATTGAAGGAAGGCTTTGG + Intergenic
1113683524 13:112261704-112261726 TGCCCATTTAGGGCAGGGTTTGG - Intergenic
1115070888 14:29320559-29320581 TGGCAATATATTGCAGGCCTGGG + Intergenic
1117172978 14:53119130-53119152 AGCTCTTGTAAGGCAGGCCTAGG - Intronic
1118725715 14:68627675-68627697 TGTCCATATAAAGCAGAACTGGG + Intronic
1118790485 14:69087181-69087203 TGCACATATAAGACAGCACTTGG - Intronic
1122696570 14:103556132-103556154 AGCCCACAGCAGGCAGGCCTGGG - Intergenic
1126074326 15:44894700-44894722 AGCTCTTGTAAGGCAGGCCTGGG + Intergenic
1129145205 15:73640901-73640923 GGCACAGATAAGGTAGGCCTAGG + Intergenic
1129682224 15:77664372-77664394 TTCCCATAACAGACAGGCCTGGG - Intronic
1131529311 15:93178623-93178645 TGCCCTTCTGTGGCAGGCCTTGG - Intergenic
1133294600 16:4745210-4745232 TGGCCATAAATGGCAGGGCTGGG + Intronic
1137842615 16:51653960-51653982 TGCCCAGCTGAGGCAGGCATGGG - Intergenic
1139185737 16:64804160-64804182 TGGCCAAATAAGACAGCCCTCGG - Intergenic
1139630933 16:68231565-68231587 TGGCCGTGTAGGGCAGGCCTCGG + Exonic
1141156329 16:81599701-81599723 TGCTCTTATAAGACAGGCCCAGG - Intronic
1143104405 17:4521441-4521463 TGCCCAGAGCAGGCCGGCCTTGG - Intronic
1145059574 17:19724291-19724313 CACCCATATCAGGCAGTCCTAGG - Intergenic
1147053416 17:37815390-37815412 TGCCCATAGCTGGCAGCCCTTGG - Intergenic
1150609063 17:66718624-66718646 TGCCCTTATAAAAGAGGCCTTGG - Intronic
1150649225 17:66999064-66999086 TGCCCATCTAGTGCAGGGCTGGG - Intronic
1151009109 17:70472959-70472981 GGCCCAGATAAGCCAGTCCTTGG - Intergenic
1151329621 17:73399152-73399174 AGCCCAGGTAGGGCAGGCCTGGG - Exonic
1153998236 18:10460886-10460908 TGCACATAGAAAGCAGTCCTTGG - Intronic
1159167521 18:64722010-64722032 TGCCCATATAAAGGAGATCTCGG + Intergenic
1159560444 18:69987087-69987109 TGCCCATATAAAAGAGGCTTCGG - Intergenic
1159948562 18:74461667-74461689 TGCCCTTATAAAGGAGGCATGGG - Intergenic
1163669849 19:18620974-18620996 TGCCCCTATAAAGCGTGCCTGGG + Exonic
1163738687 19:18997363-18997385 TGCTCCCATAAGGAAGGCCTGGG + Intronic
1163855531 19:19698874-19698896 AGCCCAAGAAAGGCAGGCCTAGG - Intergenic
1165066858 19:33234653-33234675 TGCCCAAATACAGCAGGCATTGG + Intergenic
1165756399 19:38295776-38295798 TGCACCCATCAGGCAGGCCTGGG - Intronic
1166844302 19:45717457-45717479 TGCCCATATAAGGCAGGCCTTGG + Intronic
1166881399 19:45932462-45932484 TGCCCATAATGGGCTGGCCTGGG - Intergenic
926886475 2:17603371-17603393 TGCCCTTATAAAAGAGGCCTCGG - Intronic
927493061 2:23533152-23533174 TGTACACATACGGCAGGCCTGGG + Intronic
928125158 2:28610592-28610614 TACCCATATGAGGCAGGGGTTGG - Intronic
929884115 2:45863276-45863298 TGCCTATATAATGTAGCCCTTGG + Intronic
930896147 2:56448867-56448889 TGCCTTTATGAGGCAGGCCCAGG - Intergenic
931704583 2:64936949-64936971 TGCCCAGAGAAGTCAGGACTGGG - Intergenic
933561876 2:83897785-83897807 TGCAAACATAGGGCAGGCCTGGG - Intergenic
935650595 2:105378604-105378626 TGCCGAGATAACGCAGCCCTGGG - Intronic
936656850 2:114498564-114498586 TGCCCATATCGGGTTGGCCTGGG + Intronic
937496696 2:122428056-122428078 TTTCCATATATGGCAGGCATTGG - Intergenic
939254847 2:139729400-139729422 TGTCCATTTCTGGCAGGCCTAGG + Intergenic
941523974 2:166583193-166583215 AGCTCTTGTAAGGCAGGCCTGGG - Intergenic
945031662 2:205670467-205670489 TATCCATATAGGGCATGCCTGGG + Intergenic
946038880 2:216766617-216766639 TTCACAAATAAGGCAGGGCTTGG + Intergenic
948933083 2:241144703-241144725 TTCCAAGACAAGGCAGGCCTGGG + Intronic
1171192345 20:23167536-23167558 AGCCCATCCAAGGAAGGCCTGGG - Intergenic
1175514105 20:59557961-59557983 TGCCGATAAAAGGCATGCCGTGG + Intergenic
1181286157 22:21753955-21753977 TGCCCAGATATGGCCAGCCTGGG + Intergenic
1182282205 22:29224299-29224321 TGGCCTTAAAAGGAAGGCCTGGG + Intronic
954198854 3:49012449-49012471 TGCCCATGAGAGGCAGGCCTGGG + Exonic
955797528 3:62653280-62653302 TGCCTGTATAAAGGAGGCCTCGG + Intronic
961643207 3:128378284-128378306 TGCCCACATATGACAGGCCCTGG - Intronic
961664123 3:128485886-128485908 TGCCCATAGTAGCTAGGCCTGGG + Exonic
962847044 3:139282030-139282052 TGCCTATAGCAGGCAGGTCTGGG + Intronic
964509696 3:157437456-157437478 AGCACATCCAAGGCAGGCCTGGG + Intronic
967542080 3:190679745-190679767 CAGCCATATCAGGCAGGCCTAGG + Intergenic
969533159 4:7740563-7740585 AGCCCAGAGAAGTCAGGCCTCGG - Exonic
969630328 4:8332219-8332241 TGCCCTTATAAGAGAGGCTTGGG + Intergenic
973229500 4:47825285-47825307 TCCCCATAGAAGTGAGGCCTGGG + Intronic
975913400 4:79296529-79296551 TTCCCAGATAAGGAAGGCCAAGG - Intronic
980379856 4:131999480-131999502 TGCCCATATAGGAAAGGCATTGG - Intergenic
981747482 4:148065608-148065630 TGCCAACATGAGACAGGCCTGGG - Intronic
983038945 4:162901594-162901616 TGCCCATATCAGTCAGTCATTGG + Intergenic
983724844 4:170908217-170908239 TGCCCAAATAGGTCAGTCCTTGG - Intergenic
986738463 5:10684564-10684586 TGTCCATAGAAGGAAAGCCTGGG - Intronic
987456273 5:18150986-18151008 TCCCCATATCAGCCAGGCCTGGG - Intergenic
988370606 5:30363408-30363430 AGCTCTTGTAAGGCAGGCCTGGG + Intergenic
989390716 5:40897325-40897347 AGCTCTTGTAAGGCAGGCCTGGG - Intergenic
994160511 5:96551385-96551407 AGCTCTTGTAAGGCAGGCCTGGG - Intronic
995190356 5:109312892-109312914 TACCCAAATAAGGTAGGACTCGG + Intergenic
996362017 5:122659169-122659191 TGCCAATATCAGGGAAGCCTGGG + Intergenic
999607994 5:153337631-153337653 AACTCTTATAAGGCAGGCCTGGG + Intergenic
1000231105 5:159316217-159316239 AGGCCACATAAGGAAGGCCTGGG - Intronic
1001119542 5:168968338-168968360 TTCCCAAATATGGCAGGCATAGG + Intronic
1002098831 5:176847367-176847389 TCCCCATAGAAGGGAGGCCCTGG - Intronic
1004453146 6:15766178-15766200 TGCCCAGACATGGCATGCCTAGG + Intergenic
1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG + Intronic
1007692072 6:43708928-43708950 TGCTCATATTGGGCTGGCCTGGG + Intergenic
1008183353 6:48361566-48361588 TGCTCTTAGAAGGCAGGTCTTGG - Intergenic
1010459661 6:76099513-76099535 AGCTCTTGTAAGGCAGGCCTGGG - Intergenic
1015692874 6:135944774-135944796 GGCACATATAAGGCTGCCCTTGG + Intronic
1017002387 6:150005313-150005335 TGCCCAAACAAGGCAGCCGTCGG - Intergenic
1017766302 6:157609899-157609921 TGCTACTTTAAGGCAGGCCTGGG - Intronic
1018072683 6:160179406-160179428 TGCCCTTATAAAAGAGGCCTGGG - Intronic
1018634353 6:165848020-165848042 TGGCAATATATGGCAGGCCATGG - Intronic
1019493279 7:1324885-1324907 AGGCCAAAGAAGGCAGGCCTGGG - Intergenic
1019919616 7:4155117-4155139 TGCCCAAATGAGGCAGGCAGAGG - Intronic
1021464476 7:20926532-20926554 AGCTCTTGTAAGGCAGGCCTGGG + Intergenic
1022702813 7:32777369-32777391 AGCCCAAGGAAGGCAGGCCTGGG + Intergenic
1022907038 7:34867489-34867511 AGCCCAAGGAAGGCAGGCCTGGG + Intronic
1024096461 7:45986649-45986671 AGCCCATAGAAGGCAGGCCCAGG + Intergenic
1032305451 7:130729842-130729864 TGCCTCTAGAAGGCAGGTCTGGG + Intergenic
1032956911 7:136982616-136982638 AGCTCTTGTAAGGCAGGCCTGGG + Intronic
1034856733 7:154556866-154556888 TTCCCAAACAAAGCAGGCCTTGG - Intronic
1038779325 8:30557024-30557046 AGCTCATTTAAGGCAGGGCTGGG - Intronic
1040293980 8:46139798-46139820 AGCCCATACAAGACAGCCCTGGG + Intergenic
1040294487 8:46142173-46142195 TGCCCATCTGGGGCAGCCCTGGG + Intergenic
1040383241 8:46893343-46893365 TGCCCTTAGTAGGCAGGCCCAGG + Intergenic
1046972330 8:120236792-120236814 AGCTCTTGTAAGGCAGGCCTGGG + Intronic
1050475810 9:6039802-6039824 TACCCACATCAGGCTGGCCTAGG - Intergenic
1053729190 9:41035231-41035253 TGCCCATAAATGCCAGGCCCTGG - Intergenic
1054699323 9:68396836-68396858 TGCCCATAAATGCCAGGCCCTGG + Intronic
1055432105 9:76254704-76254726 CGCCCATATAAGACACGTCTTGG + Intronic
1056123933 9:83515936-83515958 AGCTCTTGTAAGGCAGGCCTGGG - Intronic
1056816659 9:89806678-89806700 AGCCCCTATAAGTCTGGCCTCGG + Intergenic
1057431220 9:94996086-94996108 TGTCCATATAAGGAAAGCCCAGG - Intronic
1061089395 9:128418498-128418520 TGCCCTTATAAAAGAGGCCTGGG - Intronic
1062235998 9:135507888-135507910 TGCACATACAAGTGAGGCCTAGG - Intergenic
1186471869 X:9827975-9827997 TGCCCTTAAAGGGCAGGACTGGG - Intronic
1187405110 X:18996769-18996791 TGCCCAGTCAAGGCAGGCCAGGG + Intronic
1187828976 X:23361824-23361846 AGCTCTTGTAAGGCAGGCCTGGG + Intronic
1189815584 X:44821654-44821676 TGCACTTATAAGAGAGGCCTGGG - Intergenic
1198067395 X:133112331-133112353 AGCCCTTTTAGGGCAGGCCTGGG - Intergenic
1199458745 X:148059546-148059568 TGCACATAGCAGGCAGGCCCTGG + Intergenic
1201535735 Y:15046203-15046225 TCCCTTTATAAGTCAGGCCTGGG + Intergenic
1201563319 Y:15341379-15341401 AGATCTTATAAGGCAGGCCTGGG + Intergenic