ID: 1166848410

View in Genome Browser
Species Human (GRCh38)
Location 19:45744933-45744955
Sequence GGATGTTAACACATGGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166848406_1166848410 5 Left 1166848406 19:45744905-45744927 CCAAATGGCAGGGTTGAGTGAAC 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1166848410 19:45744933-45744955 GGATGTTAACACATGGACTAGGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166848410 Original CRISPR GGATGTTAACACATGGACTA GGG Intronic
903655195 1:24944602-24944624 GGATCCTCACACATGGAATAGGG + Intronic
906863067 1:49382921-49382943 GGATTTGAACTCATGGGCTAAGG - Intronic
908178494 1:61579979-61580001 GGATTTTAACAGTTGGACCAGGG - Intergenic
908970009 1:69816389-69816411 GGATTTCAACACATGAACTTGGG + Intronic
909300953 1:74012680-74012702 GGGTGTTAACACAGACACTAAGG - Intergenic
909919082 1:81357728-81357750 GGAAGTTAATACATTGCCTAAGG + Intronic
918445333 1:184611614-184611636 GGATGGTAAAACATGGAGGAAGG + Intronic
918939499 1:190973198-190973220 GAATGATAACACATGGACATAGG - Intergenic
919026012 1:192171558-192171580 GGATGTTTTCACCTGGACAAAGG - Intronic
921046539 1:211481769-211481791 AGCTGGAAACACATGGACTATGG + Intronic
1063031482 10:2239705-2239727 GGATTTTAACATATGAACTGGGG - Intergenic
1070524700 10:77285683-77285705 GGGTGTTACCACATGGCATAGGG + Intronic
1071493193 10:86150661-86150683 GGATTTTAACACATGAATTTTGG - Intronic
1074763005 10:116681439-116681461 GGATGGTTAGACATGGACGATGG + Intronic
1075413133 10:122243762-122243784 GGATGTTTCCAGATGAACTATGG - Intronic
1075529758 10:123219370-123219392 GGATGTCAACACCAGGACAAGGG - Intergenic
1076338647 10:129727884-129727906 GGATTTGAACACATGGAGTAAGG + Intronic
1079095562 11:17507818-17507840 GGATGGCAACACATGGAGGATGG - Intronic
1081050800 11:38338319-38338341 GGATGAGAACACATGGACACAGG + Intergenic
1082896876 11:58201162-58201184 GGATTTTAACACATGAATTTTGG + Intergenic
1083236580 11:61354785-61354807 GGCTGTCAACACAGGTACTAAGG + Intronic
1085045482 11:73350525-73350547 CGAAGTTAACACTGGGACTATGG - Intronic
1086643215 11:89186171-89186193 GGATGTGAGCACATGGAGAATGG + Intronic
1086932057 11:92704438-92704460 GGATTTTAACACATGGATTTTGG - Intronic
1086988443 11:93275870-93275892 GGAGGGCACCACATGGACTATGG + Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093426667 12:19035715-19035737 GAATGAAAACACATGGAGTATGG + Intergenic
1095222957 12:39640110-39640132 GGATGTTAACATATGAACTTGGG - Intronic
1096103985 12:48986192-48986214 TGATGTGAGCACATGGAGTAGGG - Intergenic
1098662517 12:73114349-73114371 GTATATTAACAGATGTACTATGG - Intergenic
1100705362 12:97194874-97194896 TGATGTTAACACTTGGAGGATGG + Intergenic
1100779667 12:98010544-98010566 GGATTTCAACATATGGACTTTGG - Intergenic
1108777686 13:53785882-53785904 GAATCTGAATACATGGACTAAGG + Intergenic
1108958380 13:56188787-56188809 GGAGGTGAACACATGGACACAGG + Intergenic
1109616666 13:64842702-64842724 GGACTTTAACATCTGGACTAAGG + Intergenic
1110823340 13:79942170-79942192 GGATGTGAACTGCTGGACTATGG + Intergenic
1118034653 14:61853402-61853424 GGATTTCAACACATGTACTTGGG - Intergenic
1120759276 14:88271415-88271437 GAATGTTAACACCTTGACTCTGG - Intronic
1121896540 14:97653395-97653417 GGATGTGAGCACTTGGAATATGG - Intergenic
1122057619 14:99115348-99115370 GAATGTTAGCACATGAAGTAGGG - Intergenic
1123002761 14:105304994-105305016 GGACGTCAACATATGGACTTTGG - Exonic
1124941275 15:34220700-34220722 GGATGTTAACGAATGTATTAAGG + Intergenic
1126508676 15:49439745-49439767 GGGTATTAACACATGGTATAAGG - Intronic
1127344755 15:58083280-58083302 GGATTTCAACACATGAACTAAGG + Intronic
1127466408 15:59248768-59248790 AGATGTGAACACATGAACTAAGG - Intronic
1130547438 15:84867487-84867509 GGATGTTACCACATGGCCATGGG - Intronic
1131325938 15:91445241-91445263 GGATGGAACCACATGCACTAAGG + Intergenic
1131767679 15:95697737-95697759 GGATGATAACATGTGAACTAAGG + Intergenic
1138983624 16:62300160-62300182 GAATGTTAACAAATGGATTGTGG - Intergenic
1140649031 16:77066538-77066560 TGATGAGAACACATGGACCATGG + Intergenic
1141061074 16:80871025-80871047 GGATGAGAACACATGGACACAGG - Intergenic
1141224836 16:82105080-82105102 GGATTTTGACACATGGATTTAGG - Intergenic
1141871835 16:86791982-86792004 GGATTTGAACCCAGGGACTAGGG - Intergenic
1146402216 17:32508797-32508819 AGAGGTTAAGACTTGGACTATGG - Intronic
1151057395 17:71049212-71049234 GAATGCTAACACATGGCATAAGG + Intergenic
1154421601 18:14235018-14235040 CGATGAGAACACATGGACTCGGG - Intergenic
1156069251 18:33186413-33186435 GGTTGTTAACACACATACTATGG - Intronic
1156098717 18:33566867-33566889 TGATGTTAACACATGCAGTGTGG + Intergenic
1157258690 18:46160419-46160441 CGTTGTTAAGACATGGAGTATGG + Intergenic
1160175820 18:76593114-76593136 GGATTTTAACACAGGGCCCAGGG - Intergenic
1160514234 18:79469765-79469787 GGATGGTCACCCAGGGACTATGG - Intronic
1160552823 18:79706024-79706046 GGGTTTTAACACATGGACTTGGG - Intronic
1164958645 19:32407446-32407468 GGTTGTCAACACATTTACTATGG + Intronic
1166358462 19:42241493-42241515 GTATTTTAAAACATGGACTATGG + Intronic
1166848410 19:45744933-45744955 GGATGTTAACACATGGACTAGGG + Intronic
925463604 2:4086521-4086543 GGATTTTGACACATGGATTTGGG + Intergenic
933286481 2:80389769-80389791 GAATGTTAAAACAAGGACTAGGG - Intronic
934496541 2:94806115-94806137 TGATGAGAACACATGGACTCGGG + Intergenic
935282761 2:101533484-101533506 GGATGTGCACACACGGACTTGGG - Intergenic
942142836 2:172995077-172995099 GGATCTTAACCCATGGCCTGAGG - Intronic
944645427 2:201775489-201775511 CAATGTTTACACATGGATTATGG + Intronic
1168952112 20:1809641-1809663 AGATGGTGAGACATGGACTAAGG - Intergenic
1170700691 20:18700763-18700785 GGAAGTGAAGACTTGGACTAAGG + Intronic
1171274287 20:23842445-23842467 GGATGTTAACAGATGTGATAAGG - Intergenic
1172157861 20:32841660-32841682 GGATGAGAACACATGGACACAGG - Intronic
1172342695 20:34170974-34170996 TGGTGTGAACAGATGGACTAAGG - Intergenic
1176851874 21:13924938-13924960 CGATGAGAACACATGGACTCGGG + Intergenic
1179239335 21:39575163-39575185 GGATTTCAACACATGAACTTTGG + Intronic
1182599851 22:31453160-31453182 TGATATTAACACATAGGCTATGG + Intronic
1183729847 22:39612014-39612036 GGTTGCCAACACATGAACTATGG - Intronic
950471273 3:13187990-13188012 GGATTTTGACACATGGATTCTGG + Intergenic
950704407 3:14771026-14771048 GGATTTCAACACATGAACTTTGG - Intronic
950953816 3:17029592-17029614 TGATGTTAGCACATGGACTGGGG + Intronic
954885515 3:53869981-53870003 GGATGTGATCACAAGGCCTAAGG - Exonic
955564165 3:60226075-60226097 AGATGTTAACAAATGGTCTCAGG + Intronic
958511471 3:95055020-95055042 GGATTTTAACACATGAATTTTGG + Intergenic
960254128 3:115492739-115492761 TAATGTGAACACATGGACTTAGG + Intergenic
960638629 3:119807737-119807759 GGATGTGAACACTTGGATTTGGG - Intronic
969093350 4:4713369-4713391 GGATTTCAACACATGAACTTTGG + Intergenic
969832810 4:9811470-9811492 AGATGGTAACACTTGGTCTAGGG + Intronic
970023977 4:11601392-11601414 GGATGTTAAGACAAGCATTATGG + Intergenic
970062624 4:12051771-12051793 CAATGTTAACACATGGACACAGG + Intergenic
971658069 4:29375794-29375816 GGATTTTAACATATGAATTAGGG - Intergenic
971827530 4:31645691-31645713 GGATTTTAACATATGGATTTGGG - Intergenic
973964292 4:56145463-56145485 AGATATTAACAGATGGTCTATGG - Intergenic
976517492 4:85985428-85985450 GGATGAGAACACATGGACAGAGG + Intronic
978271420 4:106894304-106894326 GGATGTTTTCAGAGGGACTAGGG - Intergenic
978297721 4:107226900-107226922 GGATCTTAACACAAGGAGTTTGG - Intronic
981916255 4:150036650-150036672 GTTTGTTAACACATGAACAAGGG + Intergenic
982743178 4:159079192-159079214 GGATGTCAACACATGAATTTTGG - Intergenic
983347877 4:166549957-166549979 AGATGTTAACAAATGGCTTAAGG + Intergenic
985818969 5:2147071-2147093 GGATTTCAACACATGGATTTGGG + Intergenic
989462317 5:41714750-41714772 CAATGTGAACACATGGACTCAGG + Intergenic
990509260 5:56475477-56475499 GCATGTGAACACATGGACACAGG + Intronic
991994121 5:72370511-72370533 GCATGTTAGCACTTGGACTTCGG - Intergenic
992107654 5:73463375-73463397 GGATTTTAACACATGAATTTTGG - Intergenic
996856381 5:128012253-128012275 GAATGTTCACACCTGGACCAGGG + Intergenic
997404787 5:133636760-133636782 TGATTTTAATAGATGGACTATGG + Intergenic
1000845336 5:166272778-166272800 GGATTTTAACACATGAACTCTGG + Intergenic
1000997917 5:167977557-167977579 GGATGTTAAGACATTTTCTAAGG + Intronic
1001363392 5:171111055-171111077 GGAAGAAAACACATGGACAAAGG - Intronic
1002353976 5:178608627-178608649 TGATGTGAGCATATGGACTATGG - Intronic
1005500502 6:26425144-26425166 GGATGTTCACACATGGCTTAAGG + Intergenic
1006215244 6:32436489-32436511 GGACGTTAACAAATGTGCTAGGG - Intergenic
1007866760 6:44979412-44979434 AGATATTAACACTTGGCCTATGG + Intronic
1011770250 6:90667737-90667759 GGATGTTAACACATGAATCTTGG + Intergenic
1011931561 6:92721155-92721177 CAATGATAACACATGGACAAAGG + Intergenic
1014619514 6:123648233-123648255 GGATTTCAACACATGAACTTGGG + Intergenic
1014648909 6:124011082-124011104 GGATATTAAAACATAGAGTAAGG - Intronic
1015639337 6:135314151-135314173 GGATTTTAACACATGAATTTGGG - Intronic
1016238772 6:141902650-141902672 CAATGATAACACATGGACCAGGG - Intergenic
1018540835 6:164877447-164877469 GGATTTTAACACATGAATTGTGG + Intergenic
1020749589 7:12123627-12123649 TGATGTTAACAGATGGAATGGGG - Intergenic
1020896156 7:13942597-13942619 TGATGAGAACACATGGACAAAGG - Intronic
1027688723 7:81313063-81313085 GGTGGTTAACACATGGGCTAGGG + Intergenic
1028008531 7:85610834-85610856 CAATGTGAACACATGGATTAAGG + Intergenic
1028746061 7:94328136-94328158 CAATGAGAACACATGGACTAAGG + Intergenic
1028809298 7:95066037-95066059 GGACTTTAACACATGAACTTGGG - Intronic
1028997283 7:97115340-97115362 GGATATTAACAGATGAAGTATGG + Intergenic
1031322432 7:120348093-120348115 GGATGTCAACATATGAATTATGG + Intronic
1031715497 7:125104160-125104182 GAATGAGAACACATGGACTCAGG + Intergenic
1034646923 7:152656012-152656034 GGATGAGAACACATGGACACAGG + Intronic
1035748400 8:1978192-1978214 TGATGAGAACACATGGACTCAGG - Intronic
1036705123 8:11040783-11040805 GGATGTCAACACATGCATTTGGG + Intronic
1037087241 8:14867714-14867736 TGATGTGAACACATGGACCGAGG + Intronic
1040285042 8:46095224-46095246 GGATGTTGACACATGCAGTGGGG + Intergenic
1040840678 8:51781088-51781110 GGATTTTAACACATGAATTTTGG + Intronic
1046574714 8:116013067-116013089 AGATATTAACACAAGGGCTAGGG - Intergenic
1047326328 8:123839836-123839858 GCATGTTAACATATGGAGTATGG + Intergenic
1051312891 9:15795383-15795405 AGATTTTAACACATGAACTTTGG + Intronic
1051972523 9:22907736-22907758 GGATGCTAAAACATGGTTTACGG + Intergenic
1052327036 9:27226528-27226550 GGATGAGAACACATGGACACAGG + Intronic
1053500547 9:38585954-38585976 TGATGAGAACACATGGACTCAGG + Intergenic
1053660608 9:40274332-40274354 TGATGAGAACACATGGACTCGGG - Intronic
1053910982 9:42903676-42903698 TGATGAGAACACATGGACTCGGG - Intergenic
1054372729 9:64420550-64420572 TGATGAGAACACATGGACTCGGG - Intergenic
1054524003 9:66101952-66101974 TGATGAGAACACATGGACTCGGG + Intergenic
1054680355 9:67910325-67910347 TGATGAGAACACATGGACTCGGG - Intergenic
1057762747 9:97889843-97889865 GGATTTCAACACATGAACTAGGG + Intergenic
1058924301 9:109646485-109646507 GCCTGTTATCACATGGACTTAGG + Intronic
1059116108 9:111600943-111600965 GGATTTTAACACATGAAATTGGG + Intergenic
1059741631 9:117156563-117156585 GGTTGTGAACCAATGGACTAAGG + Intronic
1059910693 9:119040828-119040850 GGATGTCAACACAAAGACAATGG + Intergenic
1186647830 X:11526025-11526047 CAATGTTAAGAAATGGACTAAGG - Intronic
1191139417 X:57100548-57100570 AAATGTGAACACATGGACAAAGG + Intergenic
1192338888 X:70245426-70245448 GGATATTAACATATGAATTATGG + Intergenic
1194387813 X:93278473-93278495 TGATGTTCACTCATGGTCTACGG - Intergenic
1194957568 X:100198608-100198630 GGATGTCAACACATGAATTTTGG - Intergenic
1196964562 X:121041901-121041923 CAATGTTAACACATGGACACAGG + Intergenic
1198174600 X:134142932-134142954 GGATTTTAACACATGAATTTGGG + Intergenic
1198481505 X:137045640-137045662 GGATTTCAACACATGAACTTCGG + Intergenic
1200979229 Y:9246830-9246852 GCATGAAAACAAATGGACTAAGG - Intergenic
1201609183 Y:15822108-15822130 GAATGAGAACACATGGACAAAGG + Intergenic
1202116650 Y:21475446-21475468 GCATGAAAACAAATGGACTAAGG - Intergenic