ID: 1166848568

View in Genome Browser
Species Human (GRCh38)
Location 19:45745907-45745929
Sequence AAAGCCACTGAGACTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166848568_1166848571 0 Left 1166848568 19:45745907-45745929 CCAATATCAGTCTCAGTGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 176
Right 1166848571 19:45745930-45745952 TTCACTTGTTTGGTTGTTTTGGG 0: 1
1: 0
2: 8
3: 87
4: 1323
1166848568_1166848569 -10 Left 1166848568 19:45745907-45745929 CCAATATCAGTCTCAGTGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 176
Right 1166848569 19:45745920-45745942 CAGTGGCTTTTTCACTTGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 189
1166848568_1166848570 -1 Left 1166848568 19:45745907-45745929 CCAATATCAGTCTCAGTGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 176
Right 1166848570 19:45745929-45745951 TTTCACTTGTTTGGTTGTTTTGG 0: 1
1: 0
2: 6
3: 119
4: 1219
1166848568_1166848572 1 Left 1166848568 19:45745907-45745929 CCAATATCAGTCTCAGTGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 176
Right 1166848572 19:45745931-45745953 TCACTTGTTTGGTTGTTTTGGGG 0: 1
1: 0
2: 6
3: 62
4: 809
1166848568_1166848573 9 Left 1166848568 19:45745907-45745929 CCAATATCAGTCTCAGTGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 176
Right 1166848573 19:45745939-45745961 TTGGTTGTTTTGGGGTTTTTAGG 0: 1
1: 3
2: 21
3: 156
4: 907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166848568 Original CRISPR AAAGCCACTGAGACTGATAT TGG (reversed) Intronic
900686378 1:3950747-3950769 AGAGGCTCTGAGACAGATATAGG + Intergenic
906983323 1:50655372-50655394 AAAGCCAATTAGACTGAAAGTGG + Intronic
907167143 1:52422966-52422988 TAAAACACTGAGACTAATATTGG - Intronic
907792704 1:57682795-57682817 AAAGCCTCTCAGAGGGATATGGG - Intronic
909354320 1:74690130-74690152 ACAGGCACTGGGACTGATAGGGG + Intergenic
919850614 1:201669619-201669641 AAAGTCACTGAGGCTGCTGTGGG + Intronic
919894590 1:202001526-202001548 AAAGCCACTGGGCCTGATCAAGG + Intronic
921896181 1:220403941-220403963 AAAGAAACTGAGACAGAAATGGG - Intergenic
922608437 1:226906059-226906081 AAAGCCACTTAGACTGCCTTAGG + Intronic
1064962183 10:20977459-20977481 ATATCCACTGAAACTGATAACGG + Intronic
1066447503 10:35497349-35497371 GAAACCACTGAGGCTGATGTGGG - Intronic
1066507287 10:36058358-36058380 CCAGCCACTGCTACTGATATGGG - Intergenic
1068525394 10:58123266-58123288 AAAACCACTGTAACAGATATGGG + Intergenic
1068846662 10:61684139-61684161 AATTCCACTTAGAATGATATAGG + Intronic
1069122613 10:64586327-64586349 AAAGCCAGATAGACTGATAGTGG + Intergenic
1071146619 10:82582152-82582174 AAAGCAACTAAGACTGAAAAGGG - Intronic
1073642011 10:105262420-105262442 AAAGTCACTGAGTGTGATTTTGG - Exonic
1073893807 10:108130848-108130870 AAAGCCAGTTAGTCTCATATGGG - Intergenic
1073969688 10:109033206-109033228 AAAGCAACTGAGACTCAAAGAGG - Intergenic
1074035631 10:109735403-109735425 AAAACCACTGAGACCGTTATTGG + Intergenic
1076351557 10:129818391-129818413 AAAGCGACTGACACCCATATGGG - Intergenic
1077875785 11:6303848-6303870 AAAGTCACAGAGACTCATGTCGG - Intergenic
1079370995 11:19852107-19852129 TAGCCCACTGAGACTGATTTTGG + Intronic
1083969366 11:66064089-66064111 AAAGGCACTGAGACAGGGATGGG + Intronic
1087155107 11:94894448-94894470 ACAGGCCCTGAGCCTGATATAGG - Intergenic
1087904614 11:103681233-103681255 TAAACCACTTAGAATGATATTGG - Intergenic
1090693773 11:129215481-129215503 TAGCCCACTGAGACTGATTTTGG - Intronic
1091049534 11:132354948-132354970 GAACCCAGTGAGACTGATTTTGG - Intergenic
1093726428 12:22516152-22516174 CAAGACACTGATTCTGATATAGG + Intronic
1094752900 12:33434233-33434255 AAAGCAACTGAACTTGATATAGG - Intronic
1096755018 12:53792226-53792248 GAACCTACTGAGACTGAGATGGG - Intergenic
1097896353 12:64827472-64827494 AAAGGAATTGAGACTGAGATAGG + Intronic
1098209353 12:68147178-68147200 TTAGTCACTGAGACTGATTTTGG + Intergenic
1098355977 12:69612917-69612939 AAATCCACATATACTGATATGGG + Intergenic
1098894251 12:76039413-76039435 ACAGACTCTGGGACTGATATGGG - Exonic
1100603168 12:96129743-96129765 TAAGCCACTGACACTGACAATGG - Intergenic
1102157927 12:110745253-110745275 AAAGCCACTGGTGCTGATAATGG - Intergenic
1103584542 12:121942238-121942260 AAACCCACAGAGACAGATAATGG - Intronic
1107809863 13:44189785-44189807 AAAGCCGCTCTGACTGATGTGGG - Intergenic
1108244010 13:48497049-48497071 AAAGCCACTGTGACTGCCACAGG - Intronic
1109266045 13:60201483-60201505 TAGCCCACTGAGACTGATTTTGG - Intergenic
1112693829 13:101925814-101925836 AAATCCAGTGAGATTGATTTGGG - Intronic
1115683204 14:35765198-35765220 AAAGGCACTGTTACTGATGTAGG - Intronic
1116536038 14:46031426-46031448 AAAGTCACTGAGATTGTGATAGG + Intergenic
1116601650 14:46932718-46932740 CAAGTCACTCAGACTGAAATAGG + Intronic
1118864602 14:69693167-69693189 AAAGCCACTACCACTGCTATAGG - Intronic
1119526743 14:75328731-75328753 AAAGCCACTGACACTGCTGTCGG - Intergenic
1121718437 14:96092515-96092537 ACAGCCAGTGAGACAGATACAGG - Exonic
1125278837 15:38023020-38023042 AAAGCCACTGGGATTTTTATTGG - Intergenic
1127508220 15:59615230-59615252 ACAGCCACTGAGACATAAATAGG - Intronic
1133514050 16:6490131-6490153 AACCCAACTGAGACTGAGATAGG - Intronic
1138487531 16:57356316-57356338 TAGTCCACTGAGACTGATTTAGG - Intergenic
1139160962 16:64508014-64508036 ACAGGCACTGAGACTAACATAGG - Intergenic
1139304079 16:65968524-65968546 AAAGCCACTGGGACTGTTCAGGG + Intergenic
1139374585 16:66488836-66488858 AAGCCCAGTGAGACTGATTTTGG + Intronic
1142104831 16:88296957-88296979 GAAGCCACACAGACTGATGTTGG + Intergenic
1142705839 17:1693707-1693729 AAGGCCACAGAGACTGAAACGGG + Intergenic
1147183795 17:38703094-38703116 AAAGTCACTCAGGCTGAAATCGG - Intergenic
1147588048 17:41664224-41664246 ACAGCCAGTGAGGCTGTTATAGG - Intergenic
1149595064 17:57860511-57860533 TAAGCCACTGAGCCTGGTCTTGG + Intergenic
1152285663 17:79411330-79411352 AAACCCACTGAGACTCATTCTGG + Intronic
1154965481 18:21351584-21351606 AAAGGCACAGAGATGGATATGGG + Intronic
1158637557 18:59174983-59175005 AAAGCCACTGAAAAGGAAATTGG - Intergenic
1158696441 18:59708293-59708315 TAGCCCACTGAGACTGATTTTGG - Intergenic
1159653300 18:71003079-71003101 AAAGTCACTGAAACTGAGGTAGG + Intergenic
1162470156 19:10868282-10868304 AAGGACACTGAGGCTGATAATGG + Intronic
1164065923 19:21716942-21716964 AAAGCCCCTTAGACTGTTCTGGG + Intergenic
1165541148 19:36492743-36492765 CAAGACACAGAGACTGATAGTGG + Intergenic
1166848568 19:45745907-45745929 AAAGCCACTGAGACTGATATTGG - Intronic
925627093 2:5852411-5852433 AAAGCCAGTGAGCCTGGAATGGG + Intergenic
928397129 2:30951385-30951407 AAATCCACTGAGACAGAGAGCGG + Intronic
930157427 2:48119627-48119649 ACAGCCACTGATACTGTTACAGG - Intergenic
932139939 2:69266714-69266736 AAGGACACTGAGACTGTTCTAGG - Intergenic
932270950 2:70409066-70409088 AATGCCATTGAGACTTTTATAGG - Intergenic
932783023 2:74574746-74574768 AAAGCCATTGTGACTGAAACAGG - Intronic
933984115 2:87576214-87576236 AAAGCCACTGACCCTCATCTTGG - Intergenic
935382601 2:102467731-102467753 AAAGTAACTGAGACTGAAAGAGG + Intergenic
935471379 2:103464650-103464672 AAAGGCACTGGGACTGAAAAAGG - Intergenic
935959545 2:108411042-108411064 ACAGCCACTTAGAATGACATTGG - Intergenic
936560330 2:113532889-113532911 AAAGCTCCTGAGACATATATAGG - Intergenic
936658577 2:114516910-114516932 AAAGCCACAGATACTGCTAATGG + Intronic
938756580 2:134385774-134385796 AAAGCCACTGAAGATAATATTGG + Intronic
939950509 2:148467092-148467114 AATGCCAGTGAGACTGTTACAGG - Intronic
943491733 2:188561932-188561954 AGTGCCACTGAGACTGAGAATGG - Intronic
944832584 2:203547936-203547958 TAGACCACTGAGACTGATTTTGG - Intergenic
948111694 2:235461536-235461558 AAAGACACAGAGACAGACATAGG + Intergenic
1168888024 20:1273852-1273874 AAAGACACTGAGACTCAGAGAGG + Intronic
1171433409 20:25101737-25101759 AAACCAACTGTGACTGATTTAGG + Intergenic
1172051018 20:32118197-32118219 AAAGCTACAGATACTGATCTCGG - Intronic
1173894872 20:46543029-46543051 GAAGGCACAGAGAATGATATTGG + Intronic
1174845485 20:53939133-53939155 AAAGCCACTGATACCAATAATGG + Intronic
1175004092 20:55663857-55663879 ATAGCCATTCTGACTGATATGGG - Intergenic
1176936719 21:14876185-14876207 AAAGCCACTGAGAGTGGTTGAGG + Intergenic
1176954209 21:15081811-15081833 AAAGCCAGTGACATTGATTTTGG - Intergenic
1176961979 21:15169330-15169352 ACCACCCCTGAGACTGATATTGG + Intergenic
1177352613 21:19963886-19963908 AAATCCACTGATAGTTATATTGG + Intergenic
1178472990 21:32910941-32910963 AAATACACTGAGGCTGATAATGG + Intergenic
1181379494 22:22489563-22489585 AAGGACACTGAGACTGAAAGAGG + Intronic
951802318 3:26609814-26609836 AAATATACTGAGGCTGATATAGG + Intergenic
952216287 3:31281000-31281022 AAAGCCCCTGAGATTGGGATGGG - Intergenic
952727881 3:36607502-36607524 AAAGTCACTCAGATAGATATTGG - Intergenic
952751140 3:36825889-36825911 AAAGCCACTGCTACTGAACTGGG + Intergenic
955846939 3:63174016-63174038 AAATCCACTGATAATTATATTGG - Intergenic
956707524 3:72012006-72012028 AAAGCCACTGAGACTAGGCTTGG + Intergenic
958739713 3:98054850-98054872 AAAGCCACTGTGCCTCATTTGGG - Intergenic
960320396 3:116227860-116227882 AAATTCAGTCAGACTGATATTGG + Intronic
962055373 3:131865896-131865918 CAAGCCACTGACACTTCTATGGG + Intronic
963641689 3:147868087-147868109 AAAGCCAATATGACAGATATTGG - Intergenic
964455112 3:156855881-156855903 AAAGCCAGTGAGACTCTTCTGGG - Intronic
970604729 4:17668325-17668347 CAAGCTACTAAGAATGATATAGG - Intronic
970642587 4:18083936-18083958 AAATCCTCTGTGACTGATCTTGG + Intergenic
972375679 4:38467681-38467703 AAATCCATTGAGACTGTTCTTGG + Intergenic
973101303 4:46274710-46274732 AAAGCCACTGAGGCTCAGAAAGG - Intronic
974849719 4:67390028-67390050 AAAGCCAATGAACCTGGTATTGG + Intergenic
975027827 4:69574907-69574929 AAAGTCACTGAGTGTGATAGGGG + Intergenic
975298543 4:72763195-72763217 AAGACAACTGAGACTGAAATTGG - Intergenic
979765098 4:124455059-124455081 TAAGACACTGAGACTAATAGAGG - Intergenic
984823278 4:183903259-183903281 AAGGCCACTGTGGCTGAAATTGG - Intronic
987180751 5:15365740-15365762 AAAGTCAATGAAAGTGATATTGG + Intergenic
987225871 5:15840984-15841006 AAAGCCAGTGACATTGCTATAGG - Intronic
992013302 5:72552283-72552305 AAAGCCAATGAGAATGAAGTTGG + Intergenic
992709363 5:79434292-79434314 AAAGCCACTGAAAATTATCTTGG - Intronic
992949472 5:81843849-81843871 AAAGCCATTGAAAATGATTTTGG - Intergenic
994408170 5:99372241-99372263 ACAGCCATTGTGACTGGTATTGG + Intergenic
996115864 5:119617574-119617596 TAAGCCACTGAGATTTTTATGGG + Intronic
997026458 5:130068288-130068310 AAATCCTCTGAAACTGAAATGGG - Intronic
998159555 5:139805770-139805792 AAGGCCACTGTGGCTGATGTGGG + Intronic
999731790 5:154480922-154480944 AAAGCAACTAGGACTCATATGGG - Intergenic
1000436625 5:161218596-161218618 AAAGCCAGTGTGGCTGAAATGGG + Intergenic
1005922201 6:30412105-30412127 CAAGGCACGGAGACTGATAGTGG - Intergenic
1007532692 6:42556765-42556787 AAAGAAACTGAGACTCATAAAGG - Intergenic
1007935192 6:45726552-45726574 GAAGCGACAGGGACTGATATGGG + Intergenic
1008014262 6:46500747-46500769 AAAGCCACTGCCACCCATATTGG + Intergenic
1008078009 6:47166182-47166204 AAAGCCACCTATACTGATTTTGG + Intergenic
1009779835 6:68255855-68255877 AAAGCCACTGTGAGGGATGTGGG + Intergenic
1015140191 6:129922219-129922241 AATGCCACCAAGACTCATATTGG + Intergenic
1015556851 6:134471164-134471186 AAAACCACTGAGACTGGCCTTGG + Intergenic
1018737189 6:166696130-166696152 ACAGCAACTGACTCTGATATGGG + Intronic
1019833343 7:3356095-3356117 AAAGCTAATGAGGCTGACATGGG - Intronic
1020093561 7:5355072-5355094 AACACCACTGACACTGACATGGG + Intronic
1022233704 7:28440629-28440651 AAAACCACTGAGGCAGAAATTGG + Intronic
1024632718 7:51262743-51262765 ACAGCCACTGAGACTGCCCTGGG - Intronic
1025946650 7:66109897-66109919 TAACCCAGTGAGACTGATTTAGG - Intronic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1029993000 7:104979249-104979271 AAAGCCACAGACACAGACATGGG - Intergenic
1030399475 7:109030480-109030502 AAAGTCACTGATTCTGATCTGGG + Intergenic
1030548574 7:110930402-110930424 AAAGCAAATGATAGTGATATAGG + Intronic
1030910413 7:115241369-115241391 AAAGCTACTGAAACTAATAAGGG - Intergenic
1031327179 7:120416287-120416309 AAAGGCTCTGAGGCAGATATAGG - Intronic
1031552567 7:123133154-123133176 GAAGACACTGAGACTGAGAATGG + Intronic
1032639490 7:133750022-133750044 TAAGCCACTGAGACCAAAATGGG + Intronic
1035970321 8:4240620-4240642 AAAGGCACTGGGAATGAGATTGG - Intronic
1039603389 8:38861029-38861051 AAAAAAACTGAGACTGAAATAGG - Intergenic
1043312287 8:78875917-78875939 AAAGCCCCTCAGACTAATAGCGG - Intergenic
1043756438 8:84009724-84009746 AAAGCCATAGAGAGAGATATAGG + Intergenic
1046146976 8:110172957-110172979 AAAGCCACTGAAATTAAAATTGG + Intergenic
1046627801 8:116593688-116593710 CAAGCCAATGAGAGTGATCTGGG + Intergenic
1047007720 8:120638307-120638329 AGAGGCACTGAGACGGATAGTGG - Intronic
1048770903 8:137893704-137893726 AGAGCCACTGTGAATGACATGGG - Intergenic
1049289132 8:141792257-141792279 GAAGACACTGAGACTCAGATGGG + Intergenic
1049892348 9:82458-82480 AAAGCTCCTGAGACATATATAGG + Intergenic
1054694642 9:68348017-68348039 AAAGCTCCTGAGACATATATAGG - Intronic
1054910155 9:70447208-70447230 AGAACCACTGCGAGTGATATAGG - Intergenic
1056072313 9:83000326-83000348 AAAGCCACAGTGAATGATAACGG + Intronic
1058167006 9:101631675-101631697 AGAGCCAATAAGACAGATATGGG - Intronic
1060834256 9:126743157-126743179 AAAGCCACTGTGAGTGTTACAGG + Intergenic
1186970562 X:14837863-14837885 AAAGAAACTGAGACTGAGACAGG - Intergenic
1187280157 X:17852469-17852491 CCAGCCTCTGAGAGTGATATGGG - Intronic
1188592444 X:31854092-31854114 AAAGGCACTTAGAAGGATATAGG - Intronic
1188729556 X:33630443-33630465 ACAGGCCCTGAGACTGGTATAGG + Intergenic
1189089864 X:38070328-38070350 AAAGCAACTGAGAGTCAAATAGG - Intronic
1190565702 X:51728617-51728639 AAAGCCACTGAGATTTAAATGGG - Intergenic
1195081492 X:101375730-101375752 AACTCCACTGAGGCAGATATTGG + Intronic
1195752398 X:108171913-108171935 AAAGCCACAGAGAGAGATCTTGG + Intronic
1197034871 X:121861131-121861153 AAAGACACTAAGACAGATATTGG - Intergenic
1198342744 X:135731105-135731127 AAATCCACAGAGCATGATATGGG - Intergenic
1198345245 X:135752190-135752212 AAATCCACAGAGCATGATATGGG + Intergenic
1199867498 X:151865996-151866018 TAGGCCACTGAGACTAATTTTGG - Intergenic
1199924193 X:152445362-152445384 AAAGTCACTGAGAATAAGATGGG - Intronic
1200427190 Y:3034588-3034610 ACTGCCACTGAGAGTGATCTGGG + Intergenic
1201652459 Y:16304917-16304939 GAAGACACTGAGACTGAAAAAGG - Intergenic