ID: 1166852306

View in Genome Browser
Species Human (GRCh38)
Location 19:45766674-45766696
Sequence CCTGGGGCCCCTGGCCCAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 404}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166852306_1166852320 17 Left 1166852306 19:45766674-45766696 CCACTTGGGCCAGGGGCCCCAGG 0: 1
1: 0
2: 4
3: 41
4: 404
Right 1166852320 19:45766714-45766736 TGGTCCCGGAGCAGCCACCTGGG 0: 1
1: 0
2: 0
3: 17
4: 171
1166852306_1166852314 -3 Left 1166852306 19:45766674-45766696 CCACTTGGGCCAGGGGCCCCAGG 0: 1
1: 0
2: 4
3: 41
4: 404
Right 1166852314 19:45766694-45766716 AGGACCTCCTCTCCAAGGGCTGG 0: 1
1: 0
2: 3
3: 22
4: 175
1166852306_1166852316 3 Left 1166852306 19:45766674-45766696 CCACTTGGGCCAGGGGCCCCAGG 0: 1
1: 0
2: 4
3: 41
4: 404
Right 1166852316 19:45766700-45766722 TCCTCTCCAAGGGCTGGTCCCGG 0: 1
1: 0
2: 1
3: 18
4: 244
1166852306_1166852311 -7 Left 1166852306 19:45766674-45766696 CCACTTGGGCCAGGGGCCCCAGG 0: 1
1: 0
2: 4
3: 41
4: 404
Right 1166852311 19:45766690-45766712 CCCCAGGACCTCCTCTCCAAGGG 0: 1
1: 0
2: 2
3: 29
4: 276
1166852306_1166852309 -8 Left 1166852306 19:45766674-45766696 CCACTTGGGCCAGGGGCCCCAGG 0: 1
1: 0
2: 4
3: 41
4: 404
Right 1166852309 19:45766689-45766711 GCCCCAGGACCTCCTCTCCAAGG 0: 1
1: 0
2: 7
3: 39
4: 389
1166852306_1166852323 26 Left 1166852306 19:45766674-45766696 CCACTTGGGCCAGGGGCCCCAGG 0: 1
1: 0
2: 4
3: 41
4: 404
Right 1166852323 19:45766723-45766745 AGCAGCCACCTGGGCCCCTTTGG 0: 1
1: 0
2: 2
3: 26
4: 259
1166852306_1166852319 16 Left 1166852306 19:45766674-45766696 CCACTTGGGCCAGGGGCCCCAGG 0: 1
1: 0
2: 4
3: 41
4: 404
Right 1166852319 19:45766713-45766735 CTGGTCCCGGAGCAGCCACCTGG 0: 1
1: 0
2: 2
3: 19
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166852306 Original CRISPR CCTGGGGCCCCTGGCCCAAG TGG (reversed) Exonic
900309006 1:2024545-2024567 CCTGGGGTCCCTCACCAAAGAGG - Intronic
900483544 1:2910735-2910757 CCCAGGGACCCTGGCCCAAGGGG + Intergenic
900625906 1:3608456-3608478 CTTGGAGCCCATGGCCCCAGTGG + Intronic
900644657 1:3703410-3703432 CCTGGGGCCCTGGGCCACAGAGG + Intronic
900705909 1:4080037-4080059 CCTGGGGGCCCTGGGCCATGCGG - Intergenic
900923734 1:5690311-5690333 CCTGGGTCCCCTGGGCCCAATGG - Intergenic
900933240 1:5749444-5749466 CCAGGGGCTCCTGGCCCTGGAGG + Intergenic
900954300 1:5877203-5877225 CCTGGGGCCCCTTGCCCTGCCGG + Exonic
901003042 1:6158254-6158276 CCTGGGGACGCTGGGCCCAGGGG + Intronic
901134936 1:6986973-6986995 GCTGGGGAACCTGGCCCTAGGGG - Intronic
901853336 1:12029589-12029611 CCTGGGGCCCACGCCCTAAGGGG - Intronic
902677113 1:18016401-18016423 CCAGGGTTCCCTGGCCCCAGAGG + Intergenic
902713691 1:18257905-18257927 CAGGGGGCCCCTTGCCCACGGGG - Intronic
903284790 1:22269867-22269889 CCAGGGGCCTCTGCTCCAAGTGG + Intergenic
903342096 1:22660934-22660956 CCTGGAGCCCCAGGCCCCAAAGG + Exonic
903796715 1:25934561-25934583 CTTGGGTCCACAGGCCCAAGGGG - Intergenic
904213135 1:28898742-28898764 CCTGGGGCCCAAGGCCAAGGCGG - Intronic
904276134 1:29385510-29385532 TCTGGGGTCCCTGGGCCAAGAGG - Intergenic
905465201 1:38147964-38147986 GCTGGGTCCTATGGCCCAAGTGG - Intergenic
905639207 1:39576884-39576906 CCTCGGGCCCCCGGGCCGAGTGG - Intergenic
906149473 1:43579182-43579204 CATGGGGCTCCGGGCCCATGCGG - Intronic
906492377 1:46278618-46278640 CCTGGGAACCCTGGGCCAGGAGG - Exonic
910561879 1:88599845-88599867 GCTGGGTCACATGGCCCAAGTGG - Intergenic
911858938 1:102921543-102921565 CCTGGTCCTCCAGGCCCAAGAGG - Exonic
912548311 1:110466872-110466894 CCTGGGCACCCTGCCCCATGAGG + Intergenic
912733346 1:112128965-112128987 CCTGGGTCACATGGCCCAAGTGG + Intergenic
912977861 1:114346267-114346289 CCCGGGGGCCCTGGGCCAGGAGG - Intergenic
914845735 1:151282636-151282658 CCTGGCGCCCCCGGCTCGAGAGG + Intronic
915728389 1:158035250-158035272 CCTGGGGCCCTAGTCCCAAGGGG - Intronic
916212269 1:162368537-162368559 GCTGTGGTCCCTGACCCAAGTGG - Exonic
916716518 1:167451364-167451386 CCTTGGGCCCCTGGGCTAACTGG + Intronic
919623741 1:199890939-199890961 CCTGGGTCCCCTGCCCCACTAGG + Intergenic
919972717 1:202591372-202591394 CCTGCGGCCCCTGGCCCCATGGG - Exonic
920190524 1:204190759-204190781 CCTGGGCCTCCTGGCCCCCGGGG - Exonic
920243469 1:204570725-204570747 CCTGGGTCCCCTAGCCCAGCAGG - Intergenic
920541570 1:206782724-206782746 CCTGGGGCCCCTTGGAGAAGGGG - Intergenic
920652800 1:207851366-207851388 CCTGGGGCCCCTGACTTCAGCGG - Intergenic
922074837 1:222233420-222233442 TCTGGGTCCCCTTGGCCAAGAGG - Intergenic
1064694058 10:17948154-17948176 CTTGGGTCCCCTTGGCCAAGAGG - Intergenic
1065010600 10:21417345-21417367 CCTGGGCCCCTGGGCCCTAGTGG + Intergenic
1065552576 10:26884011-26884033 CCTGGGACCCCTGGCTGCAGTGG + Intergenic
1067083441 10:43226094-43226116 CCTGCGGCCCCTGGCACCACTGG - Intronic
1067210892 10:44259753-44259775 CCTGGAGCTCCCGGCCCATGAGG + Intergenic
1067723199 10:48745709-48745731 CGTGGGGCGCCTGGCTCAAGAGG - Intronic
1069632002 10:69902790-69902812 CCAGGCCCCCCTGGACCAAGTGG + Exonic
1070671676 10:78381655-78381677 GATGGCACCCCTGGCCCAAGAGG - Intergenic
1072230416 10:93409669-93409691 TCAGGGGCCCTGGGCCCAAGGGG - Exonic
1072240281 10:93489513-93489535 CCTGGTCCCCTTGCCCCAAGTGG + Intergenic
1072582408 10:96750698-96750720 TCTGGGGCGCCTGGCTCACGAGG + Intergenic
1073305751 10:102502337-102502359 CCTTGGGCCCTTGGCTCTAGGGG - Intronic
1073509176 10:104032700-104032722 CCTGGGCCACCTGGCCCTCGAGG - Exonic
1073557327 10:104465764-104465786 GCTGGGTCACATGGCCCAAGTGG - Intergenic
1074170991 10:110936801-110936823 TCTGGGGCACCTGGCTCACGAGG - Intronic
1075463085 10:122631733-122631755 CCTGGGGACCCTCGCCGAGGGGG + Intronic
1075871374 10:125774303-125774325 CCTGGGGGCCCAGTCCCGAGGGG - Exonic
1076520504 10:131078102-131078124 CCTGTGCCTCCTGGCCCCAGTGG + Intergenic
1076670909 10:132120709-132120731 CCTGGGGACCCTGTCCCAATGGG + Intronic
1076723167 10:132401560-132401582 AGTGGGGCCCCTGTCCCTAGGGG + Intronic
1077175832 11:1190009-1190031 CCCGGTGCACCTGGACCAAGTGG + Intronic
1077239288 11:1502293-1502315 CCTGAGGCCCCTGGCCTGGGTGG - Intergenic
1077288462 11:1778024-1778046 CCTGAGGCCCCTGGGGCCAGGGG - Intergenic
1078360984 11:10667430-10667452 CCTGGGGCCCCTGCCCAACTTGG - Intronic
1078781275 11:14441478-14441500 TCTGGGGCACCTGGCTCATGAGG + Intergenic
1080648347 11:34203527-34203549 CCTGGGTCCCCTGTCCCCTGAGG - Intronic
1081660022 11:44882336-44882358 CCTGAGGCCCCTGCTCCCAGCGG + Intronic
1083327225 11:61878892-61878914 ACTGGGGCCCCAGGCCCTGGCGG - Intronic
1083330018 11:61893112-61893134 GCTGGTGGCCCTGGCCCAAGGGG + Intergenic
1083621756 11:64052808-64052830 CCAGGGGCCCTTTGCCCAGGTGG + Intronic
1083921921 11:65786025-65786047 CCTCAGGCCCCAGGCCCACGTGG - Intergenic
1083993901 11:66262807-66262829 CCTGCAGCCCCTAGCCCAGGAGG + Exonic
1083995319 11:66268846-66268868 CCTGGGGCCCCTGGGGGGAGGGG - Intronic
1084680939 11:70665988-70666010 CATGGGGCACCTGGCCTATGCGG - Intronic
1084743565 11:71154557-71154579 CATGGGGGCCCTGGCCAAGGGGG + Intronic
1084792242 11:71482220-71482242 CCTGGGGCTTCGGGCCCATGTGG + Intronic
1085311185 11:75517842-75517864 CTTGGGGCCCCTGTCCCACCTGG - Intronic
1087310499 11:96536258-96536280 CCTAGGCCCTCTGGCCCTAGTGG + Intergenic
1087743148 11:101912725-101912747 CCAGGGTCCCCTTGGCCAAGAGG - Intronic
1088143954 11:106652231-106652253 CCTGGTGCCCTTGGCTCCAGTGG - Intergenic
1088885032 11:113999488-113999510 GCTGGGGCCCCAGACACAAGCGG - Intergenic
1088898357 11:114094770-114094792 CAGGAGGTCCCTGGCCCAAGGGG + Intronic
1089012587 11:115143099-115143121 CCTGACTCCCCTGGCCCGAGTGG + Intergenic
1089095308 11:115915301-115915323 TCTGGGGCCCCTGCACCATGGGG + Intergenic
1089317243 11:117600501-117600523 CCTGGGGCTCCAGGTCCCAGGGG + Intronic
1089377077 11:118002055-118002077 CCTGGCTCCCCTTGCCCAGGAGG + Intergenic
1089519571 11:119054942-119054964 CCTGGGGAGCCTGGCCCTAAGGG + Intronic
1090358949 11:126159770-126159792 GCCTGGGCCCCTGGCCCCAGCGG + Intergenic
1091214177 11:133890372-133890394 CCTGAGGGTCCTGGGCCAAGGGG - Intergenic
1091758459 12:3071710-3071732 TCTGGGGCGCCTGGCTCACGAGG - Intergenic
1091831739 12:3554927-3554949 CCTGAGTCCCCAGGCCCAGGTGG + Intronic
1092879363 12:12875909-12875931 TCTGGGGCGCCTGGCTCACGAGG + Intergenic
1094839157 12:34335722-34335744 CCTGGGGGCCCCGTCCAAAGCGG + Intergenic
1096424322 12:51488409-51488431 TCTGGGTCCCCTGTGCCAAGGGG + Intronic
1096557413 12:52411902-52411924 CCTGGGGCCACAGGCTCCAGTGG - Intergenic
1096622680 12:52874318-52874340 CCTGGGGCCCCCGGCCGCCGTGG - Intergenic
1099134946 12:78885640-78885662 CCTGCAGCACCTGGCCCACGTGG - Intronic
1101434417 12:104652790-104652812 CCTGTGGAAGCTGGCCCAAGGGG + Intronic
1102733148 12:115132381-115132403 CCTGGGGCCTCAGGCACAATTGG - Intergenic
1102969620 12:117155754-117155776 CGCGGGGCCACTGGCACAAGCGG + Intronic
1103344868 12:120242473-120242495 CCTGGGCCCTCTGGCCCCAGTGG - Intronic
1103520929 12:121536843-121536865 CCTGGGGCCCGCAGCCCAAGAGG - Intronic
1103728145 12:123009177-123009199 CCTGAGGCCCATGACCCAAAAGG - Intronic
1103748139 12:123140253-123140275 CCTGTGGCCACTGGGCTAAGAGG - Intronic
1104786000 12:131448327-131448349 GCTGGGGGCCCTGACCCAGGAGG + Intergenic
1105254422 13:18732546-18732568 CATGGGGCCACTGCACCAAGGGG + Intergenic
1108828087 13:54440883-54440905 TCTGGGGCGCCTGGCTCATGAGG - Intergenic
1108855845 13:54791608-54791630 CCTGGGGACACTGGTGCAAGGGG + Intergenic
1112365428 13:98752143-98752165 GCAGGGAACCCTGGCCCAAGAGG - Intronic
1112450706 13:99506653-99506675 CCTGTGGCCCCTCACCAAAGTGG + Intronic
1113421366 13:110173971-110173993 CCTGGGACTCCTGGCCCCACAGG - Exonic
1113453729 13:110432331-110432353 CCTGGACCCCCTGGACCAAAAGG + Exonic
1113484367 13:110643520-110643542 GCTTGGGCCCCAGTCCCAAGCGG + Intronic
1113704570 13:112419310-112419332 CCAGAGGCCCCAGGCACAAGGGG + Intronic
1113709983 13:112456823-112456845 CCTGGGACCCCTGGCCCTCGCGG - Intergenic
1113887145 13:113666991-113667013 TCTGGGGCCCCTGGCTGGAGAGG - Intergenic
1113901650 13:113801299-113801321 TCACGGGCCCCTGTCCCAAGAGG - Intronic
1114266035 14:21073122-21073144 CCTGGAACACCTGGCCCAACAGG - Exonic
1114271298 14:21101955-21101977 ACTGAGGCTCCAGGCCCAAGAGG - Exonic
1114460739 14:22884748-22884770 CCTGGGGCCCCCAGACGAAGAGG + Exonic
1114559003 14:23577828-23577850 CTTGGGGCCCCAACCCCAAGCGG + Intronic
1115510395 14:34132555-34132577 CCTGGGGCCTGTTACCCAAGAGG + Intronic
1115852410 14:37598666-37598688 CCTCGGGCCCCGGGCCCAGACGG + Intronic
1116530906 14:45972287-45972309 ACTGGGACACCTGTCCCAAGAGG - Intergenic
1116620773 14:47200754-47200776 ACTGGGGCGCCTGGCTCACGAGG - Intronic
1117616231 14:57536502-57536524 CTTGGGGCCCATGGCACAATTGG - Intergenic
1119219263 14:72893198-72893220 TTTGGGGCTCCTGGCCCGAGGGG - Intronic
1119262227 14:73244672-73244694 CCTGGGGACCCTGGAGCCAGTGG + Exonic
1119543690 14:75456907-75456929 CCTGGGGACTCAGGACCAAGAGG - Intronic
1122326496 14:100883795-100883817 CGTTGAGCCCCTGGCACAAGTGG + Exonic
1122327354 14:100890646-100890668 CCTGGGGCCCCTGGCTCTCTGGG + Intergenic
1122406181 14:101502408-101502430 GCTGGAGCCCGTGGCCCAGGAGG - Intergenic
1122409316 14:101517925-101517947 CCTGGAAGCCCTGGCCCACGAGG - Intergenic
1122900257 14:104779482-104779504 CCGGGGGCCCCTCCTCCAAGGGG - Intronic
1123110244 14:105863829-105863851 CCAGGGTTCCCTGGCCCCAGGGG + Intergenic
1202903194 14_GL000194v1_random:54850-54872 CATGGGGGCACAGGCCCAAGGGG - Intergenic
1124964570 15:34423676-34423698 ACTGGGACCCATGGCCCCAGGGG - Intronic
1124981192 15:34569903-34569925 ACTGGGACCCATGGCCCCAGGGG - Intronic
1125751202 15:42030338-42030360 CATGGGGCTCCTGGAGCAAGTGG + Intronic
1126532440 15:49725591-49725613 CCTGGTACCCCTGTCCCCAGTGG + Intergenic
1126697746 15:51340586-51340608 CCTGGGGCCCCAGGACCTATGGG - Intergenic
1128078035 15:64840773-64840795 CCTGGGGCTCCCAGGCCAAGGGG - Intergenic
1130208570 15:81901465-81901487 CCTGGGGAAGCTGGCCCATGTGG - Intergenic
1132641798 16:981563-981585 CGTGGGGCGCCTGGCCCACGTGG + Intergenic
1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG + Intergenic
1132724742 16:1333838-1333860 CCTGGGGGACCCGGACCAAGGGG - Intronic
1132726169 16:1339220-1339242 CCTGAGAGCCCTGGCCCCAGAGG + Exonic
1132851116 16:2025489-2025511 CCAGGGGGCCATGGCCCAGGAGG + Intronic
1134036566 16:11035930-11035952 AATGGGGCCCCTGGCCCAGAAGG + Intronic
1134042021 16:11076276-11076298 CCTGAAGCCGGTGGCCCAAGGGG - Intronic
1134088238 16:11373204-11373226 TGTGGGGCTCCTGGCCCTAGAGG + Intronic
1135290623 16:21234931-21234953 CCTTGAGCCCCAGGCTCAAGTGG + Intronic
1136513539 16:30753941-30753963 CCTGAGGCCCAGGGCCCAGGTGG - Intronic
1139472867 16:67187538-67187560 CCCGGGGGACCTGGCCCAGGGGG + Exonic
1139599615 16:67978714-67978736 CTTGGGGCCACTGACCCAAATGG - Intronic
1141496716 16:84415213-84415235 CCTGGGGCATGTGGCCCACGTGG + Intronic
1141700961 16:85641842-85641864 CGTGGGCCTCCTGGGCCAAGGGG + Intronic
1141949914 16:87333715-87333737 GCTGGGGAACATGGCCCAAGGGG + Intronic
1141950271 16:87335250-87335272 CTGGGGGCACCTGGCCCAAGTGG - Intronic
1141989907 16:87603623-87603645 CCTGGTGCCCACGGCCCAACCGG - Intronic
1142195400 16:88737199-88737221 CCTGGGGCCACTGGGCCACCTGG + Intronic
1142286218 16:89172533-89172555 CCTGGGGGCCCAGCCCCCAGAGG + Intronic
1142296029 16:89223022-89223044 CCTGGGACCACTGGGCCATGGGG + Intronic
1142329889 16:89445070-89445092 CCTGGGCACCCTCACCCAAGGGG - Intronic
1142686248 17:1578395-1578417 CCTGGGGGCCCTCACCCCAGGGG + Intronic
1142898212 17:2995820-2995842 CCTGGGGGCCCTGGTCATAGAGG + Intronic
1142998629 17:3776640-3776662 CCTCGGCCTCCGGGCCCAAGTGG + Intronic
1143090303 17:4445983-4446005 CCTCGGGTCCCTGGCCCTATGGG + Intronic
1144153399 17:12473232-12473254 CCTGGTGTCCCTTGTCCAAGAGG + Intergenic
1144725196 17:17498332-17498354 CCTGGGGCTCTAGTCCCAAGAGG + Intergenic
1145014368 17:19387076-19387098 CCAGAGGCCCCTGGCCACAGAGG - Exonic
1145346467 17:22044866-22044888 GCTGAGGCCCCGGGCCCCAGGGG + Intergenic
1148793991 17:50188564-50188586 CCTGGTGCCCCTGGCCCCGTTGG - Exonic
1149662076 17:58339258-58339280 GCTGGGACCACTGGCCCAGGAGG + Intergenic
1150226771 17:63528695-63528717 CCTGAGGCCCCTGCCCCCTGAGG + Intronic
1151196083 17:72432051-72432073 GATGGGTCCCCTGGCTCAAGTGG - Intergenic
1151399045 17:73843682-73843704 CCTGAGGCCCGTGGCCCACAGGG - Intergenic
1151548862 17:74809715-74809737 CCTGGCCCCCCAGGTCCAAGGGG + Intronic
1151946360 17:77322027-77322049 CCTGGGGCTGGTGGCCCAGGAGG - Intronic
1152017560 17:77761571-77761593 CCTCGTGCCCCTGGCCCAAAGGG - Intergenic
1152095418 17:78269225-78269247 CCTTGGGCCCCTGGAACAATGGG + Intergenic
1152591258 17:81213756-81213778 CCTTGGTCCCCTGGCCAAGGTGG - Intronic
1152687368 17:81701195-81701217 AATGGGACCCCTGGCCCCAGTGG + Intronic
1152710129 17:81867255-81867277 CTTGTGGCCCCTGGCGCACGTGG - Intergenic
1152732840 17:81981305-81981327 CTGGGGTCCCCTGGGCCAAGAGG + Intronic
1152792754 17:82290974-82290996 TCTGGGACCCCTTGGCCAAGAGG + Intergenic
1153217722 18:2835767-2835789 GCTGGGTCCTATGGCCCAAGTGG + Intergenic
1153480653 18:5543576-5543598 CCTGGGATCCCTGGCCGAAGGGG - Intronic
1154436606 18:14348076-14348098 CATGGGGCCACTGCACCAAGGGG - Intergenic
1155565619 18:27131221-27131243 TCTGGGGTCCCTGGGCCAGGAGG - Intronic
1155940682 18:31799433-31799455 ACTGGGTCACATGGCCCAAGTGG - Intergenic
1156450931 18:37266203-37266225 CCTGGTGCTCCTGGGCAAAGTGG + Intronic
1156466072 18:37348504-37348526 ACTTGAGCCCCTGGCCCCAGAGG - Intronic
1157519734 18:48337213-48337235 CCTGGGGCAGGAGGCCCAAGAGG - Intronic
1157776062 18:50397206-50397228 CCAGGGGACCCTTGCCCAACAGG - Intergenic
1158589720 18:58768993-58769015 TCTGGGGCCCCTGGGGCAGGGGG + Intergenic
1159023044 18:63158519-63158541 CCTGGGGCCCCTTCCTCCAGAGG + Intronic
1159278310 18:66249842-66249864 GCTGGGTCTCATGGCCCAAGTGG + Intergenic
1159601604 18:70433381-70433403 CTGGGGTCCCCTGGACCAAGAGG + Intergenic
1160990138 19:1857075-1857097 CCCGGGCCCCCTGGCCCCGGCGG - Intronic
1161032447 19:2064447-2064469 CCTGTGGCCCCGCGGCCAAGCGG + Intergenic
1161055846 19:2190325-2190347 CCGGGGGCCCCTGGTGCATGGGG + Intronic
1161348162 19:3778152-3778174 GGTGGGGCCCTTGGCCCCAGAGG - Exonic
1161353978 19:3809050-3809072 CCTGGGGTCCCTGGGACAGGAGG + Intronic
1161585216 19:5102080-5102102 CCAGGGGACCCTGGGCCATGAGG + Intronic
1161828528 19:6586109-6586131 CCTGACGCCCCTGGCCCGAGGGG - Exonic
1162039667 19:7962880-7962902 CCCGTGGCCCCCGGCCCCAGTGG + Exonic
1162479682 19:10921136-10921158 CCTGCTGCCCCTGGCCCTGGGGG - Intronic
1162778382 19:12993946-12993968 GCTGGGGACCCTGGAGCAAGGGG - Intergenic
1162797115 19:13092684-13092706 CCTGGGACCCCCTTCCCAAGGGG - Intronic
1162799521 19:13103036-13103058 CCTGGGGCCCGGGTCCCCAGAGG - Intronic
1162806591 19:13140562-13140584 CCTGGGGTCCCTGAAACAAGTGG - Exonic
1162966104 19:14156846-14156868 CCTGAGGGTCCTGGTCCAAGGGG + Intronic
1163291822 19:16384045-16384067 CCTGGAGCCCATGGCCCAGGTGG - Intronic
1163440505 19:17320383-17320405 CCTGGGGCCCCTGGCGTGGGGGG - Exonic
1164856460 19:31528424-31528446 CAGGGCTCCCCTGGCCCAAGTGG + Intergenic
1165175904 19:33929555-33929577 CGTGCGGCCCCTGGCCCAGGTGG - Intergenic
1166706108 19:44908890-44908912 CCTGGGGCCCCTGGTGGAACAGG + Exonic
1166790648 19:45396674-45396696 CCTGGGGCCCCTCCGCCAGGGGG + Exonic
1166812153 19:45521172-45521194 CCTGAGGCTCCAGGCCCAGGAGG - Intronic
1166852306 19:45766674-45766696 CCTGGGGCCCCTGGCCCAAGTGG - Exonic
1167438091 19:49491433-49491455 TCTGGGGCGCCTGGCTCACGAGG + Exonic
1167476973 19:49706749-49706771 TCTGGGGTCCCTGGGCCTAGGGG - Intronic
1168076174 19:53981983-53982005 CCTGGGCCCGCTGGCGCAGGCGG + Intronic
1168113780 19:54209527-54209549 CCTTGTGCTTCTGGCCCAAGAGG + Intronic
1168121965 19:54256684-54256706 CCAGGGGCCCCTGACACCAGAGG + Exonic
1168187351 19:54708669-54708691 CCAGGGTCCCCTGGCACCAGAGG - Intergenic
1168269432 19:55241569-55241591 GCTGGAGCTCCTGGCCCAGGGGG - Exonic
1168415332 19:56164218-56164240 CCTGGGGGCCCTGGCACCAGGGG + Intergenic
925390426 2:3490443-3490465 CCTGGGGCGCCAGGCTCATGGGG - Intergenic
925976566 2:9146173-9146195 CGTTGGGCACATGGCCCAAGAGG - Intergenic
928907521 2:36382700-36382722 CCTGTGTCTCCTGGCTCAAGGGG + Intronic
929119026 2:38468643-38468665 CCTTTGGCTCCTGGCTCAAGTGG - Intergenic
933682188 2:85111989-85112011 CCTGGGTCACCTGGCCTAAGTGG - Intergenic
933686754 2:85147604-85147626 CCTGGGGCCCCTGGCCCAGCTGG - Intronic
933743051 2:85550053-85550075 CCTGGAGCAGCTGGCCCAGGAGG - Exonic
934489382 2:94749426-94749448 CATGGGGCCACTGCCCCATGGGG + Intergenic
934717460 2:96552001-96552023 CCTGGGGCCTGTGCCCCCAGAGG + Exonic
934887545 2:98038075-98038097 CCAGGGGCTCCTGGCCCATTTGG - Intergenic
934953134 2:98592929-98592951 CCTGGGGCCCCTGGCAGGGGAGG - Intronic
935425135 2:102911490-102911512 GCTGGGTCCTATGGCCCAAGTGG + Intergenic
936085078 2:109461752-109461774 CCTGGGTCATGTGGCCCAAGTGG + Intronic
936172034 2:110185319-110185341 CCTGGGGTCCCTGGGCCACATGG - Intronic
937060041 2:118974365-118974387 CCTGGTGCCCCTGGCCCGCCGGG + Exonic
937377312 2:121346241-121346263 CCTGAGGCCCCAGGCCCAGCTGG + Intronic
937800306 2:126074565-126074587 GCTGGGTCCTATGGCCCAAGTGG - Intergenic
938933868 2:136111730-136111752 CCGGGGGCAACTGGCCCAACAGG - Intergenic
941188539 2:162346644-162346666 ACTGGGGCCCCTGGCCAACAAGG + Intronic
942047552 2:172108632-172108654 GCTGGGGCCCTTGACCCAGGAGG + Intergenic
942061507 2:172232299-172232321 CCTGGGGCCCTTGCCACAGGAGG + Intergenic
942625349 2:177894491-177894513 CTTGGGTCCCCTTGGCCAAGAGG - Intronic
942987884 2:182163832-182163854 CTTGGGTCACATGGCCCAAGTGG - Intronic
946182164 2:217955319-217955341 CCAGGGGCCCCAGGACCATGTGG + Intronic
946391740 2:219420366-219420388 CCTGGGGTCACTGGGCCATGGGG + Intronic
946442271 2:219706781-219706803 CCTGGGGCCCTGGGGCCATGAGG + Intergenic
947749168 2:232523869-232523891 CCTGGGACCCCGGGCACAGGCGG - Exonic
948407973 2:237737008-237737030 CCTGAGGTCCCAGCCCCAAGTGG + Intronic
948900381 2:240953790-240953812 CCTGGAGCCGCTGGCCCAGGAGG + Intronic
949032322 2:241802947-241802969 CCACGGGCCCCTGGCACAGGGGG - Intronic
1169192858 20:3669025-3669047 CCTGGGGCCCCAGTCCTTAGGGG - Intronic
1169410411 20:5364498-5364520 CTTGGGTCCCCTTGGCCAAGAGG + Intergenic
1169831445 20:9830002-9830024 CATGGGGCTCCTGGGCCCAGTGG - Intronic
1172122945 20:32609333-32609355 CCTGGGGCTCCTGACCCAGCGGG - Intergenic
1172574480 20:35997151-35997173 GCTGGGGTCCTTGACCCAAGTGG - Intronic
1174160676 20:48548168-48548190 CCTTGGGCCCATGGCTCATGGGG - Intergenic
1175249968 20:57603344-57603366 CCTGGGTCCCCAGGCCCTGGTGG - Intergenic
1175380129 20:58557149-58557171 CCTGTGGCCACAGGCCCCAGTGG - Intergenic
1175791991 20:61745681-61745703 CCTGGGGACCCTGTCCCATGGGG + Intronic
1175792103 20:61746229-61746251 CCTGAGGACCCTGTCCCATGGGG + Intronic
1176070394 20:63223246-63223268 CCTGGAGCCCCTGGTCCAAGAGG - Intergenic
1176106432 20:63391767-63391789 CCTGGGCCCCCGGGCCCAAGGGG + Intergenic
1176196198 20:63837202-63837224 CCAGGGGCCCCTGGCCTCTGAGG + Intergenic
1176377825 21:6095556-6095578 CCTGGCTCCCCTGGGCCACGCGG + Intergenic
1176622558 21:9069617-9069639 CATGGGGGCACAGGCCCAAGGGG - Intergenic
1176759353 21:10763023-10763045 CTTGGGGCCTCTGGTCCAAAAGG - Intergenic
1176840437 21:13837579-13837601 CATGGGGCCACTGCACCAAGGGG + Intergenic
1177757238 21:25362230-25362252 TCTGGGGCGCCTGGCTCACGAGG + Intergenic
1179745649 21:43442692-43442714 CCTGGCTCCCCTGGGCCACGCGG - Intergenic
1179818485 21:43922905-43922927 CATGGGGCGCCTGTCCCCAGCGG + Intronic
1179932493 21:44579655-44579677 CATGGGGGCCCCGTCCCAAGCGG + Exonic
1179957213 21:44748246-44748268 CTTGGGTCCCCTTGGCCAAGAGG + Intergenic
1180180015 21:46114035-46114057 CCTGGGCCCTCTGGCCCCAAGGG + Exonic
1180189665 21:46156620-46156642 CCTTGGTCCCCAGGCTCAAGAGG + Intergenic
1180614945 22:17120821-17120843 CCTGGGGCCGCCGGCTCAGGTGG - Exonic
1181039142 22:20183783-20183805 CCTGGGGCACCTGGGCACAGTGG + Intergenic
1181049481 22:20231823-20231845 CCTGGGGCCCCTGGCCAGCACGG - Intergenic
1181052467 22:20244329-20244351 CATGGGGCCCCTGCCCCACTGGG + Intronic
1181063433 22:20293169-20293191 CCTGGATCCCCTGGCCCTGGTGG + Intergenic
1181830855 22:25559153-25559175 CCTGCTGCCACTGGCCCAGGTGG + Intergenic
1181891153 22:26064846-26064868 GCTGGGGTCCAGGGCCCAAGAGG - Intergenic
1182122721 22:27797869-27797891 CCTGGGGCCCCAGGACCCGGAGG - Exonic
1182284060 22:29233619-29233641 CCTGGGCCTCCTGGCCCCACAGG + Exonic
1183427355 22:37746779-37746801 CCTGGGGCCCCTGGCCGCCTTGG - Intronic
1183486379 22:38089453-38089475 CCTGAGGCCCCGGGCCCCCGCGG + Intronic
1183669526 22:39264340-39264362 CATGGAGCCCATGTCCCAAGAGG + Intergenic
1183672773 22:39282948-39282970 CCTGGAGCCCCTGACCTCAGAGG - Intergenic
1183830975 22:40418286-40418308 GAGGGGTCCCCTGGCCCAAGAGG + Intronic
1184041968 22:41949662-41949684 CCTGGGGACCCTGGTCCCAGAGG + Intergenic
1184527536 22:45034313-45034335 CCTGGGGACCCTGGCTCCACCGG + Intergenic
949417622 3:3831046-3831068 CCTGGGTCATATGGCCCAAGTGG + Intronic
950576643 3:13836231-13836253 CCTAGGGACACTGGCCCAATGGG - Intronic
951323171 3:21271712-21271734 CCTGAGCCCCCTGCCCCAACCGG - Intergenic
951671574 3:25189448-25189470 GCTGGGGCCCCTGCTCCTAGGGG - Intronic
951791610 3:26491657-26491679 CCTGGGGCCCCTTCTTCAAGTGG - Intergenic
953032204 3:39186297-39186319 TCTGGGGCCCCAGGCCCCGGAGG + Exonic
953471378 3:43169566-43169588 TCTGAGGCCACTGGCCCAGGGGG - Intergenic
954135801 3:48581589-48581611 CCTGGAGACCCTGGCCCCAAGGG - Exonic
957300228 3:78382250-78382272 CCTGGGCCCCAGAGCCCAAGGGG - Intergenic
958891986 3:99794268-99794290 CGTGGAGAGCCTGGCCCAAGAGG + Exonic
958892217 3:99795003-99795025 CCTGGGGCTCTTGGACCAAGAGG + Exonic
961152849 3:124654318-124654340 CCTGGGGCCTCTGGGCAATGGGG - Intronic
961543966 3:127619146-127619168 CGTGGAGCCCCTGCCCCAGGAGG + Exonic
961662877 3:128479709-128479731 TGAGGGGCCCCTGGCCCAGGAGG - Exonic
962244294 3:133778683-133778705 CCTGGTTTCACTGGCCCAAGTGG + Exonic
962316384 3:134362093-134362115 CATGGTGCCCCTGGCACAAGTGG - Intronic
962318118 3:134371250-134371272 CCTGGAGATCCTGGCCCCAGAGG - Exonic
964617365 3:158682058-158682080 CCTGGAGCCTCTGGACCCAGAGG + Exonic
966445668 3:179998395-179998417 GCTGGGTCACATGGCCCAAGTGG - Intronic
966868884 3:184277306-184277328 CCTGGAGTCCCTGGACCGAGGGG + Exonic
967294228 3:187949629-187949651 CCTGGGGCCCATGGCCAGATTGG - Intergenic
967728209 3:192881722-192881744 CCTGGCGGCACTGGCCAAAGAGG + Intronic
967894103 3:194383092-194383114 CCCGGGGCCCCTGGACCACTCGG - Intergenic
968054424 3:195680679-195680701 GCTGGGGCCCTTGGCCCATCTGG - Intergenic
968101466 3:195968479-195968501 GCTGGGGCCCTTGGCCCATCTGG + Intergenic
968480048 4:829227-829249 CCTGGGGTCCCTGGCCTCACTGG - Intergenic
968529819 4:1085654-1085676 ACTGGGGCACCTGCCCCAAGGGG + Intronic
968958470 4:3730688-3730710 CCTGGGGCCCCAGCCCCCACTGG - Intergenic
968983651 4:3864174-3864196 CCTGGGGACCCTGACACACGAGG - Intergenic
969587855 4:8104752-8104774 CCTGGTGCCGCTGGCCCTGGAGG - Intronic
969703116 4:8778580-8778602 CCTGTGGCCCCTGGTCAGAGAGG - Intergenic
973130214 4:46639859-46639881 GCTGGGTCACATGGCCCAAGTGG + Intergenic
978459960 4:108940591-108940613 CCTGGCCCTCCAGGCCCAAGAGG - Exonic
982207679 4:153009204-153009226 CACAGGGCCCCAGGCCCAAGAGG - Intergenic
985501489 5:250475-250497 GCTGGGGCCCTTGGCCCATCTGG - Intronic
985544913 5:504667-504689 CCCGGTGCCCATGGCCCCAGAGG - Intronic
985626247 5:990060-990082 CCAGGGGGCCCAGGCCAAAGAGG - Intergenic
985659123 5:1147155-1147177 CCTGGGTCCCCTTGTCCAAGAGG - Intergenic
985723674 5:1504345-1504367 CCTGGAGCCCCGGGACCAGGTGG - Intronic
985784679 5:1887509-1887531 CCTCGGGCCCTCGGCCCACGGGG + Intergenic
986132248 5:4942403-4942425 CCTGAGGACCCTGGGCCAGGAGG + Intergenic
987316406 5:16728683-16728705 CCTGGAGACCCTGATCCAAGTGG + Intronic
990185735 5:53206977-53206999 CCTGGGGCACCTGGCTCATGAGG + Intergenic
992124476 5:73626409-73626431 CCTGGGGACCCTGGAGAAAGTGG - Intronic
994774301 5:104024784-104024806 CCTGGGGTCCCTGGCACGTGAGG - Intergenic
998041864 5:138955599-138955621 CCTGGGCCCCCTGGCCGAGCTGG - Intronic
998483978 5:142485800-142485822 CCTGCTGCACCTGGCCCAGGTGG + Intergenic
999772214 5:154784246-154784268 CCTGTGGTCCCTGCCCCCAGGGG + Intronic
999811583 5:155132524-155132546 CATGTGGCCCCTGGCCCAGTGGG + Intergenic
1001828253 5:174764204-174764226 CCTGGGGTCTCTGGCACAAAAGG + Intergenic
1002052864 5:176581456-176581478 CCTGGGGCCCCTGGACAGAGAGG + Exonic
1002072750 5:176690063-176690085 CCTGGGGCCCCTTGCTCCTGTGG - Intergenic
1002449625 5:179311221-179311243 CCTGGCGCTCCTGGCCCAGGTGG + Intronic
1002460056 5:179368886-179368908 CCTGGAGCCACTGGTCCCAGTGG + Intergenic
1003505019 6:6733752-6733774 CTTGGTGTCCCTGGCGCAAGTGG - Intergenic
1005986810 6:30881007-30881029 TCCGGGGCCCCGGGCCCAGGAGG - Intronic
1006595973 6:35192694-35192716 CCTGGGGCCACTCTGCCAAGAGG - Intergenic
1007399604 6:41596327-41596349 CCCAGGGGCTCTGGCCCAAGGGG - Intronic
1009928306 6:70146674-70146696 CCTGGAGCACCTGGTCCACGTGG + Exonic
1010121549 6:72381193-72381215 CCAGGGGCCACCGGCACAAGAGG - Intronic
1011633807 6:89352507-89352529 GCTGGGGCCCCTGGGCGAGGAGG - Intronic
1012001885 6:93664304-93664326 GCTGGGTCATCTGGCCCAAGTGG - Intergenic
1012730436 6:102874158-102874180 GCTGGGTCACATGGCCCAAGTGG - Intergenic
1016461933 6:144286584-144286606 CCTCGGACCCCGGGCCAAAGCGG - Intronic
1018679506 6:166252701-166252723 CGGGAGGCCCCTTGCCCAAGGGG - Intergenic
1018831691 6:167448516-167448538 CCCGGGGACCCTGGCTCATGGGG - Intergenic
1018845408 6:167552039-167552061 CCTGGGAGCCCTTGCTCAAGGGG - Intergenic
1019142331 6:169956778-169956800 CATGGGGCCAGTGGTCCAAGAGG - Intergenic
1019277435 7:183195-183217 CCTGGGAGTCCTGGCCCGAGGGG - Intergenic
1019388901 7:774311-774333 CCTGGGGCCCGTACCCCAAGAGG + Intronic
1019613448 7:1948279-1948301 GCTGGGGCCCATGGCGCAGGTGG - Intronic
1019733287 7:2638851-2638873 CGTGGGTCCCCTTGCACAAGTGG - Intronic
1021394717 7:20133077-20133099 ACAGGGGCACCTGGCCTAAGAGG - Intergenic
1023833782 7:44056882-44056904 CGTGGGACCCCAGGCCCCAGTGG + Exonic
1024302294 7:47896502-47896524 TCTGGGTCCCCTTGGCCAAGAGG + Intronic
1024924738 7:54600885-54600907 GCTGTGTCCCCTGGCCAAAGTGG + Intergenic
1024958279 7:54949242-54949264 CCTGGGTCATATGGCCCAAGTGG + Intergenic
1026875580 7:73877277-73877299 CCTGGGGTCCCTGGGGCAGGGGG + Intergenic
1029110518 7:98211279-98211301 CCTGGGGCTCCCGGACCAGGTGG - Intergenic
1029112155 7:98217932-98217954 CGTGGGGCCCCTGGACCAGGTGG - Exonic
1029420561 7:100469695-100469717 CTTGAGGCCCCTGCTCCAAGGGG - Intronic
1030086475 7:105819900-105819922 CGTGGGGCGCCTGGCTCACGAGG + Intronic
1030606274 7:111642226-111642248 TCTGGGTCCCCTTGGCCAAGAGG - Intergenic
1031832970 7:126649853-126649875 CCTGGGTCATATGGCCCAAGTGG - Intronic
1032786274 7:135202948-135202970 CCTGCAGGCCCTGGCCCACGTGG - Intronic
1033536944 7:142321064-142321086 CCTGGAGCCCATGGCACAAAGGG - Intergenic
1034345440 7:150382624-150382646 CCTGTGGGCTCTGGCCCAAGGGG - Intronic
1034968054 7:155403667-155403689 CCTGGAGCCAGAGGCCCAAGTGG - Intergenic
1035725858 8:1824362-1824384 GCAGGGACCCCTGGCCCCAGGGG + Intronic
1036528397 8:9556429-9556451 CCTGCTGCCCCAGGCCCCAGTGG - Exonic
1036600374 8:10255338-10255360 CCTGGGGCTCCTGGCCCGCCAGG - Intronic
1037792594 8:21959184-21959206 CCTGATGCCCCTGGCCCTACAGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1042155666 8:65841817-65841839 CCTGGGGCTCCTCGGCCGAGAGG + Exonic
1043439607 8:80265704-80265726 TCTGGGGCGCCTGGCGCACGAGG - Intergenic
1045112504 8:98948241-98948263 CCAGGGCCCTCTGGCCCAGGAGG + Exonic
1046984181 8:120369368-120369390 CCTGGCTCTCCTGGACCAAGAGG + Exonic
1048253495 8:132886828-132886850 TCTGGAGCCCTTGGCACAAGAGG + Exonic
1048860600 8:138722080-138722102 CAGGGGGTCCCTGGGCCAAGAGG + Exonic
1048879557 8:138861183-138861205 CCTGAGGCCCCTGTCCCAGCAGG - Intronic
1049090885 8:140512367-140512389 GCTGGGGCCCCTCGTCTAAGAGG + Intronic
1049255474 8:141611434-141611456 GCTGGGGCCCCTGGATGAAGAGG - Intergenic
1049447558 8:142638362-142638384 CCTTGGCCCCCAGGCCCAGGTGG - Intergenic
1049554426 8:143275021-143275043 CGTGGGGCCACTGGCGCAGGTGG - Intronic
1049655299 8:143794504-143794526 CCTGCAGGCCCTTGCCCAAGCGG - Intronic
1050062504 9:1724706-1724728 ACTGTGGCCCCTGGGCCAAATGG - Intergenic
1052840725 9:33289422-33289444 CCTGGGGTCCCTGAAACAAGTGG - Intergenic
1053668400 9:40334851-40334873 CATGGGGCCACTGCACCAAGGGG - Intergenic
1054379543 9:64474903-64474925 CATGGGGCCACTGCACCAAGGGG - Intergenic
1054516212 9:66041442-66041464 CATGGGGCCACTGCACCAAGGGG + Intergenic
1056104811 9:83336699-83336721 TCTGGGGCCTCTTGGCCAAGTGG - Intronic
1057802192 9:98197321-98197343 CCTGGGAGCTCTGGCCCAGGCGG - Intergenic
1060987537 9:127828413-127828435 CCTGGGGCCGGTGGCCAGAGGGG - Intronic
1061053070 9:128207425-128207447 CCTGGTGCCCTAGGCCAAAGGGG + Intronic
1061207510 9:129173459-129173481 CCTGGGGCCACTGGCGCAGCAGG - Intergenic
1061533740 9:131234835-131234857 CCTGGGGACTCTGGCTCCAGAGG + Intergenic
1061534902 9:131241530-131241552 CCTGGGGCGCCTGGCTCACAAGG + Intergenic
1061868209 9:133506264-133506286 CCTGGGCCCCCTGGCTAAAGGGG + Intergenic
1061878593 9:133557211-133557233 CCTGGGGCTCCTGGCTCACCAGG - Intronic
1061991842 9:134163529-134163551 CCTGGGGCCCCGGGCCAAACGGG + Intergenic
1062038748 9:134394662-134394684 CCTGAGGCCTCTGGCCCCTGAGG - Intronic
1062041367 9:134405726-134405748 CCTCCAGCCTCTGGCCCAAGGGG + Intronic
1062128995 9:134882591-134882613 CCTGGGGCCCCTGGGCCCAAGGG + Exonic
1062134247 9:134916374-134916396 CCCGGGGCCCCAGGGCCAAAGGG - Exonic
1062270545 9:135706393-135706415 CCTGGGGGCCGTGGGCCATGCGG - Intronic
1062320490 9:135988356-135988378 CCAGGAGCCCCCAGCCCAAGCGG - Intergenic
1062387455 9:136318623-136318645 CCTGGAGGCCCTGGGCCCAGGGG + Intergenic
1062392500 9:136339574-136339596 CAGGGGCCCCCAGGCCCAAGGGG - Intronic
1062501945 9:136855454-136855476 GCTGGGGCCCGGGGCCCAGGAGG - Exonic
1062541179 9:137042194-137042216 CTTGGGGCCCCTGGACCTTGTGG - Intronic
1062555047 9:137110063-137110085 CATGGGGCACCTGGTCCAGGAGG - Intergenic
1062586203 9:137251092-137251114 GCTGGGGGTCCTGGCCCAGGCGG + Intergenic
1062682104 9:137787690-137787712 CTGGCGGCCCCTGGCCCAGGCGG - Intronic
1203745753 Un_GL000218v1:40046-40068 CATGGGGGCACAGGCCCAAGGGG - Intergenic
1185816644 X:3162699-3162721 CCTGGGGCCAGTGGCCCAGGTGG - Intergenic
1187095124 X:16140125-16140147 ACTGGGACCACTGGCCCAGGAGG - Intronic
1190255205 X:48757344-48757366 CCTGGGTCCTATGGCCCAAGTGG - Intergenic
1190996775 X:55617633-55617655 GCTGGGTCCTATGGCCCAAGTGG + Intergenic
1191182703 X:57579945-57579967 CCTGGAGCCTCTGGACCAAATGG - Intergenic
1191214877 X:57923720-57923742 CCTGGAGCCTCTGGACCAAATGG + Intergenic
1191902874 X:66056773-66056795 CCTGGGGCCCGAGGCCCAGCTGG + Intergenic
1192788314 X:74355189-74355211 ACTGGGGCCCCAGGCCCCAGAGG + Intergenic
1193543661 X:82801202-82801224 GCTGGGTCACATGGCCCAAGTGG - Intergenic
1193695674 X:84704847-84704869 CATGGGGACCCTGGCTAAAGAGG - Intergenic
1194596743 X:95868112-95868134 CCTAGGGGCTCAGGCCCAAGGGG - Intergenic
1195038585 X:100992818-100992840 CCTGGGGACCCTGGGACAGGAGG + Intergenic
1195569234 X:106380453-106380475 CCTGGAGCCTCTGGACCAAATGG - Intergenic
1195654614 X:107323338-107323360 CCTGGGGCACATGGCCCAAGAGG - Intergenic
1195705780 X:107737167-107737189 CCCAGGGCCCCTGGACCAATGGG + Intronic
1196909254 X:120469052-120469074 ACTGGTGCCCCGGGCCCAGGCGG + Intronic
1200089378 X:153627193-153627215 CCAGGGGCCCCCGGCCTAAGGGG - Intergenic
1201159078 Y:11155058-11155080 CATGGGGGCACAGGCCCAAGGGG - Intergenic
1201264789 Y:12195125-12195147 CCTGGGGCCAGTGGTCCACGTGG + Intergenic