ID: 1166852779

View in Genome Browser
Species Human (GRCh38)
Location 19:45768454-45768476
Sequence CGACCCGGTGTTGCGCGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166852779_1166852783 -4 Left 1166852779 19:45768454-45768476 CCCGCGCGCGCAACACCGGGTCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1166852783 19:45768473-45768495 GTCGCTGCCACGTAGGCGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 34
1166852779_1166852785 1 Left 1166852779 19:45768454-45768476 CCCGCGCGCGCAACACCGGGTCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1166852785 19:45768478-45768500 TGCCACGTAGGCGCTCGGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1166852779_1166852788 3 Left 1166852779 19:45768454-45768476 CCCGCGCGCGCAACACCGGGTCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1166852788 19:45768480-45768502 CCACGTAGGCGCTCGGCCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1166852779_1166852784 0 Left 1166852779 19:45768454-45768476 CCCGCGCGCGCAACACCGGGTCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1166852784 19:45768477-45768499 CTGCCACGTAGGCGCTCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 31
1166852779_1166852786 2 Left 1166852779 19:45768454-45768476 CCCGCGCGCGCAACACCGGGTCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1166852786 19:45768479-45768501 GCCACGTAGGCGCTCGGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1166852779_1166852791 22 Left 1166852779 19:45768454-45768476 CCCGCGCGCGCAACACCGGGTCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1166852791 19:45768499-45768521 GGGGCAGTGCGCCCAGGAAGCGG 0: 1
1: 0
2: 3
3: 30
4: 312
1166852779_1166852789 16 Left 1166852779 19:45768454-45768476 CCCGCGCGCGCAACACCGGGTCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1166852789 19:45768493-45768515 CGGCCGGGGGCAGTGCGCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166852779 Original CRISPR CGACCCGGTGTTGCGCGCGC GGG (reversed) Exonic
905867058 1:41382216-41382238 CGGCCCGGTGCTGGGTGCGCCGG + Exonic
1064478758 10:15719530-15719552 CGACCCGGGGAGGTGCGCGCGGG - Intronic
1102519810 12:113471266-113471288 CGCCCCAGTGGAGCGCGCGCAGG + Intronic
1119326085 14:73760249-73760271 CGCCGCGGTGCCGCGCGCGCCGG - Exonic
1129539376 15:76338300-76338322 CGACCTGGTGATGAGGGCGCGGG + Exonic
1134441544 16:14302155-14302177 CGGCCCGGGGTTGGCCGCGCTGG - Intergenic
1142232007 16:88904444-88904466 CGACCTGGTGTTGCCCCCACAGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1165431389 19:35775488-35775510 CGCCCCCGTGGGGCGCGCGCCGG + Intronic
1165774377 19:38396067-38396089 CGACCCAGTGGCACGCGCGCAGG - Exonic
1166852779 19:45768454-45768476 CGACCCGGTGTTGCGCGCGCGGG - Exonic
955687984 3:61563769-61563791 CGACCCGGAGCAGGGCGCGCGGG + Intronic
969214570 4:5711536-5711558 CCACCTGGTGTCGCGTGCGCTGG - Exonic
1040471274 8:47737706-47737728 CGGCTCGCTGTTGCCCGCGCAGG - Exonic
1060552233 9:124491162-124491184 CAGCCTGGTGTTGCGGGCGCAGG - Exonic
1060758207 9:126227808-126227830 CGACCTGGAGCTGCCCGCGCTGG + Intergenic