ID: 1166856722

View in Genome Browser
Species Human (GRCh38)
Location 19:45785986-45786008
Sequence TGCCCCCGCCAGCTGGGTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166856714_1166856722 -8 Left 1166856714 19:45785971-45785993 CCGGGCCGCCCGCCTTGCCCCCG 0: 1
1: 0
2: 4
3: 42
4: 628
Right 1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG 0: 1
1: 0
2: 3
3: 9
4: 188
1166856711_1166856722 1 Left 1166856711 19:45785962-45785984 CCGCCACACCCGGGCCGCCCGCC 0: 1
1: 0
2: 3
3: 43
4: 600
Right 1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG 0: 1
1: 0
2: 3
3: 9
4: 188
1166856712_1166856722 -2 Left 1166856712 19:45785965-45785987 CCACACCCGGGCCGCCCGCCTTG 0: 1
1: 0
2: 0
3: 20
4: 415
Right 1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG 0: 1
1: 0
2: 3
3: 9
4: 188
1166856708_1166856722 11 Left 1166856708 19:45785952-45785974 CCAGGCTCTGCCGCCACACCCGG 0: 1
1: 1
2: 0
3: 35
4: 358
Right 1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG 0: 1
1: 0
2: 3
3: 9
4: 188
1166856713_1166856722 -7 Left 1166856713 19:45785970-45785992 CCCGGGCCGCCCGCCTTGCCCCC 0: 1
1: 0
2: 8
3: 47
4: 540
Right 1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG 0: 1
1: 0
2: 3
3: 9
4: 188
1166856706_1166856722 29 Left 1166856706 19:45785934-45785956 CCAATGCTGAATGGTGTGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG 0: 1
1: 0
2: 3
3: 9
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166856722 Original CRISPR TGCCCCCGCCAGCTGGGTGC GGG Exonic
900266198 1:1758456-1758478 AGCCCCTGCCTGCTGGGAGCCGG + Intronic
900428905 1:2592797-2592819 TACCCCCGCAGCCTGGGTGCTGG + Intronic
902659261 1:17890102-17890124 TGTTCCTGCCTGCTGGGTGCTGG + Intergenic
905182283 1:36174886-36174908 TTCCCCCTCCAGGTGGGAGCAGG + Exonic
905280141 1:36843916-36843938 TGGCCCCGCCAGTTGAGTGAAGG - Intronic
905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG + Intronic
905914232 1:41674046-41674068 GGCCCCAGCCAGCTGGGTTTAGG - Intronic
908501133 1:64744981-64745003 TCTCCCCGCCAGCAGGCTGCTGG + Intergenic
908817822 1:68051881-68051903 TGCCCCAGCCAGCTGAGGCCAGG + Intergenic
912845791 1:113073590-113073612 AGCGCCCTCCAGCTCGGTGCGGG - Exonic
915234251 1:154468934-154468956 TGCACGGGACAGCTGGGTGCAGG - Exonic
915912337 1:159922901-159922923 TGACCCTGCCAGCTGTGTCCAGG - Intronic
917118776 1:171627665-171627687 TGCCATTGCCAGCTGGATGCTGG + Intergenic
918247390 1:182671932-182671954 AGCCGCCGCCCGCTGGGTGTAGG - Intronic
920505028 1:206509282-206509304 TGCCCGCTGCAGCTGGCTGCAGG + Intronic
921277242 1:213532370-213532392 AAACCCAGCCAGCTGGGTGCGGG - Intergenic
923015213 1:230121220-230121242 TGCACCTGCCTGCTGTGTGCTGG + Intronic
923154590 1:231267183-231267205 TGCTCCAGCCAGCTCTGTGCAGG + Intronic
1063270884 10:4509156-4509178 GGCCACCCTCAGCTGGGTGCAGG + Intergenic
1063490359 10:6458342-6458364 TGCCCTCTCCAGCTGGCTCCAGG - Intronic
1064000842 10:11662621-11662643 GGCCCCGGCCAGCTGTGTGTTGG - Intergenic
1065622719 10:27599832-27599854 TGATCCTGCCACCTGGGTGCTGG + Intergenic
1067299433 10:44995394-44995416 TGCACCTGCCAGCTAGGAGCAGG + Exonic
1067773619 10:49145308-49145330 TGCCCCCGCCTGCAGGTTCCAGG + Intergenic
1072107908 10:92291357-92291379 TGCCCCGGGAAGCTGGGTGACGG + Exonic
1072903574 10:99430652-99430674 CGCCCCCGCCGGCTAGGTGAAGG - Intergenic
1073351935 10:102826015-102826037 TGCCCCCATCAGCTGGGTGCTGG + Intergenic
1073460667 10:103664022-103664044 TGCCCCTGCCAGCTGGGCAGAGG + Intronic
1076761995 10:132610560-132610582 GGCCCCAGCCAGCTCGCTGCAGG + Intronic
1077284261 11:1758839-1758861 TGCCCCGGCCACCTGAGGGCTGG + Intronic
1078507906 11:11965891-11965913 TGACCCCGCCAGCCGGCTTCTGG - Exonic
1081774078 11:45665771-45665793 TGCCCCCGGCGGGTGGGTGGGGG - Intergenic
1081814095 11:45929020-45929042 TGCCCCAGCCAGTTTGGGGCTGG + Exonic
1083266823 11:61550689-61550711 GTCCCCCGCCAGGTGGGTGGGGG + Intronic
1083432619 11:62622086-62622108 TGCCAGCCCCAGCTGGGAGCTGG - Exonic
1087151718 11:94866112-94866134 TTCCTCAGCCAGCTGGCTGCTGG - Exonic
1092751946 12:11727288-11727310 TGCGCCCGCCTGCGGGATGCCGG - Intronic
1101276469 12:103207161-103207183 TGCTCCCTCCACCTGAGTGCAGG + Intergenic
1101630292 12:106486353-106486375 TGCCTCCTACAGCTTGGTGCTGG + Intronic
1102471135 12:113160498-113160520 GGCTCCCGCTTGCTGGGTGCAGG - Intronic
1103195052 12:119036832-119036854 TGCTCAAGCCAGCTGTGTGCAGG + Intronic
1103945405 12:124523363-124523385 TGCCCCTGCCACCGGGGTGTGGG - Intronic
1104666414 12:130650262-130650284 TGGACCCGGCAGCTGGCTGCTGG - Intronic
1104974932 12:132548146-132548168 TCCCCCCGCCCGGTGGGTGCAGG + Intronic
1108727053 13:53194200-53194222 TGCCCCTGCCATCTAGGTACAGG - Intergenic
1110718143 13:78731161-78731183 TGCCTCCGCCTCCTGGGTTCAGG + Intergenic
1113973288 13:114207104-114207126 TGCCCACACCAGGTGGATGCGGG - Intergenic
1119475286 14:74923269-74923291 TGGCCCCGCACGCTGGATGCCGG - Intronic
1121637548 14:95463955-95463977 AGCCCCCACAACCTGGGTGCAGG + Intronic
1122418462 14:101561261-101561283 CGCCCCCGAGAGCTGGCTGCGGG + Intergenic
1123705953 15:22951375-22951397 AGCCCCGGCCGGGTGGGTGCAGG + Intronic
1127051936 15:55092935-55092957 TGCTCCTGCAAGCTGGGTTCTGG - Intergenic
1131450824 15:92538338-92538360 AGCCCCTGACAGCTGGGAGCTGG - Intergenic
1134602507 16:15544563-15544585 TGCCCCTGGCAGCCGGGAGCTGG + Intronic
1134619661 16:15678000-15678022 TGTCCCCAGCAGCTGGGTACTGG + Intronic
1134882517 16:17758117-17758139 GGCACCCGGCAGCTGAGTGCAGG + Intergenic
1135629484 16:24024732-24024754 TGCCCCAGTCAGCTGTGTTCAGG + Intronic
1135764877 16:25168945-25168967 TGCTCCCGCCAGCACCGTGCTGG + Intronic
1136288908 16:29260044-29260066 GGCCACCTCCAGCCGGGTGCAGG + Intergenic
1139651221 16:68363202-68363224 AGCCCCTGCCTGCTGGGTACAGG - Intronic
1140324593 16:73989431-73989453 TGCCTCAGCCACCTGAGTGCTGG - Intergenic
1140384599 16:74524093-74524115 TGCCTCAGCCACCTGAGTGCTGG - Intronic
1140670561 16:77273932-77273954 TCTCCCATCCAGCTGGGTGCAGG - Intronic
1141110400 16:81266772-81266794 TGCCACCGCCAGCATGGAGCAGG - Intronic
1141482018 16:84313142-84313164 CGCCCCCGCCAGGTAGGTCCTGG + Exonic
1141691304 16:85598296-85598318 TGCCCTGCGCAGCTGGGTGCTGG - Intergenic
1142067228 16:88069584-88069606 TGCCCCCACCTGCTGTGTGATGG + Intronic
1142094636 16:88232951-88232973 GGCCACCTCCAGCCGGGTGCAGG + Intergenic
1142114964 16:88351729-88351751 CTCCCCCACCAGCAGGGTGCAGG + Intergenic
1142494304 17:298220-298242 TGCCCCCACCAGCTCAGTGTGGG + Intronic
1144809184 17:17987814-17987836 TGGCCCTGGCAGCTTGGTGCTGG + Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1148037298 17:44676530-44676552 TGCCCTTTGCAGCTGGGTGCCGG + Intronic
1148558372 17:48592112-48592134 TGCCGCCGCCCGCTGGGGACCGG - Exonic
1149894992 17:60422370-60422392 TGGCCCCTCCAGCTGGGATCTGG - Intronic
1150060609 17:62065422-62065444 GGCCCCGGGCGGCTGGGTGCCGG - Intergenic
1151293236 17:73165213-73165235 TCCCCGAGCCAGCTGGGCGCCGG - Exonic
1151662502 17:75526108-75526130 TGCCCCGGCCGGCTGGGTGCGGG + Intronic
1152414888 17:80153030-80153052 TGCCCCAGCCAGTTGGGTTTAGG - Intergenic
1152583838 17:81180461-81180483 TCCCCCAGCCAGCAGGGTGGTGG - Intergenic
1152593894 17:81229049-81229071 TGTCCCCGCCTGGTGGGGGCTGG - Exonic
1152638045 17:81438230-81438252 TCCCCCCGGCGGCTGCGTGCTGG + Intronic
1152657991 17:81528809-81528831 TGCCGCAGCCAGATGGGCGCTGG + Exonic
1152691012 17:81717661-81717683 TGCCCCCGCCAGCATGTTCCTGG + Intronic
1154357102 18:13630083-13630105 TGCCTCTCCCAGCTTGGTGCTGG - Intronic
1154975125 18:21450032-21450054 TGCCCCTGTCAGCTGGTTGTGGG + Intronic
1156242552 18:35267632-35267654 TGCCCCCGCCAGGTCTGAGCCGG - Exonic
1157279795 18:46338884-46338906 TGCACCCGCCAGCGAGGAGCAGG - Intronic
1157706786 18:49813924-49813946 CGCGGCCGCCAGCTGGGGGCGGG + Exonic
1160771259 19:832176-832198 TGCACCCGACAGCGGGGTGTTGG + Intergenic
1161316619 19:3620357-3620379 TGCCCAGGGCAGCTGGGTGAAGG - Intronic
1161324389 19:3656338-3656360 TGCTCCCGCCAGCCGGGAGAAGG + Intronic
1161453518 19:4359399-4359421 TGGCCACCCCAGCAGGGTGCAGG + Intronic
1162799486 19:13102948-13102970 TGCCAGCGCCGGCTGGGGGCGGG - Intronic
1163548627 19:17952959-17952981 TGACCTCCCCAGCTGGGTCCCGG - Intronic
1165469222 19:35993964-35993986 TGGACCCCCCAGCTGGTTGCCGG + Intergenic
1166177070 19:41081778-41081800 TGCCTCCCCCATCTGGGTGGCGG + Intergenic
1166219358 19:41354762-41354784 TGCCACCAGCAGCTGTGTGCAGG + Exonic
1166856722 19:45785986-45786008 TGCCCCCGCCAGCTGGGTGCGGG + Exonic
928596506 2:32863994-32864016 TGCTCCCGGCAGCTGGAGGCTGG + Intergenic
931719192 2:65055298-65055320 TGTCAACCCCAGCTGGGTGCAGG - Intergenic
932263000 2:70342678-70342700 TGACCCCTCCATCTGGATGCTGG - Intergenic
935708481 2:105877002-105877024 TGACCCCGCCAGGTGGCAGCCGG - Intronic
938389756 2:130895471-130895493 TGTTCCCACCAGCTGAGTGCAGG + Intronic
947702044 2:232242660-232242682 TGCCCAAGGCAGCTGGGTGGGGG - Intronic
948363412 2:237438377-237438399 TGCCCTCGCCTCCTGGGTGGAGG - Intergenic
948931610 2:241135874-241135896 GGCCCCCCTCAGCTGGGTCCTGG + Exonic
1172407645 20:34701497-34701519 GACCCCCACAAGCTGGGTGCGGG + Intronic
1172705165 20:36877679-36877701 GGCCCCTGCCAGCTGAGGGCTGG - Intronic
1173015713 20:39223598-39223620 AGCCCCTGCCAGCTGGTAGCTGG - Intergenic
1175553289 20:59830805-59830827 GACCCCTGCCAGCTGGGTGATGG - Intronic
1175820021 20:61904141-61904163 GGCTCCCGCCAGCTCGGTGTGGG - Intronic
1179516041 21:41907677-41907699 TGCCTGCGGCAGCTCGGTGCTGG - Exonic
1179960716 21:44765811-44765833 TGCACCACCCAGCTGGGGGCAGG + Intergenic
1180826372 22:18864906-18864928 TCCCCCCGCCAGGTTGGTGCCGG - Intergenic
1181473068 22:23152646-23152668 TGCCTCAGCCTGCTGGGAGCCGG + Intronic
1182430093 22:30294191-30294213 TGCCTGAGCCTGCTGGGTGCTGG - Intronic
1182785443 22:32903752-32903774 TGCCCCTGCCAGCTATGAGCTGG - Intronic
1183704865 22:39470138-39470160 TGGCCTCGCCAGCAGGGTGAGGG + Intronic
1183748160 22:39704165-39704187 TGCCCCCGCCAGGAGGGAGCTGG + Intergenic
1183931860 22:41240002-41240024 TGCTCCTGCCACCTGGGAGCTGG - Intronic
1184355795 22:43978777-43978799 TGCCCCCAGCCACTGGGTGCTGG - Intronic
1184780475 22:46646573-46646595 CACCCCCGCCAGCAGGGAGCTGG - Intronic
1184846409 22:47090527-47090549 TGTCCCCTCCAGGTGGATGCTGG + Intronic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1185139346 22:49091709-49091731 AGCCCCCGCCACCCGGATGCTGG + Intergenic
1185373036 22:50469664-50469686 TGCTTCCGCCAGGTGGGTGGCGG - Intronic
1203276515 22_KI270734v1_random:90812-90834 TCCCCCCCCCAGGTTGGTGCCGG - Intergenic
950105598 3:10386377-10386399 GGCCTCCTCCAGCTGTGTGCTGG + Intronic
952744694 3:36765349-36765371 AGCCCCTGCCATCTGGGAGCTGG - Intergenic
956124050 3:65994690-65994712 TGGCTCAGACAGCTGGGTGCTGG + Intronic
959603949 3:108222100-108222122 GGCCCCGTCCAGGTGGGTGCCGG - Exonic
960639041 3:119809859-119809881 TGCCCCCTCTAGCTGAGTCCTGG + Intronic
961749305 3:129086079-129086101 TGCACGCCCAAGCTGGGTGCTGG - Intergenic
961796994 3:129416301-129416323 TGCCTCAGCCTCCTGGGTGCTGG - Intronic
962551034 3:136491908-136491930 AGCCCCCGCCTCCTGGGTTCAGG - Intronic
962694044 3:137930069-137930091 AGCCTCCGCCTGCTGGGTGCAGG - Intergenic
964720674 3:159764930-159764952 AGCCCCAGCCGGCTGGGGGCCGG + Exonic
967980761 3:195063824-195063846 TTCCCCAGACAGCTGGGGGCAGG + Intergenic
968621530 4:1605434-1605456 AGCCCCTGGAAGCTGGGTGCAGG - Intergenic
968629276 4:1641836-1641858 TGCCCACACCAGCTGGGCGGGGG - Intronic
968702781 4:2064681-2064703 TCCCACAGCCAGCTGGGGGCTGG - Exonic
969252682 4:5980059-5980081 TGACCCAGCCAGTTGGGAGCAGG - Intronic
969317822 4:6392684-6392706 TCTCCCGGCCTGCTGGGTGCAGG - Intronic
969792204 4:9499638-9499660 TGCCACCGTAAGCTGGGTGAAGG + Intergenic
970397205 4:15681304-15681326 TGGCCCCGCCAGGTCGGGGCTGG + Intronic
973613865 4:52659920-52659942 AGCCCTCGCCAGCTGCGGGCCGG + Intergenic
984698652 4:182804333-182804355 CGCCCCGGCCAGATGGGTGGTGG - Intergenic
985658944 5:1146170-1146192 TGGCCCCTCCTGCTGGGAGCAGG - Intergenic
987015085 5:13810093-13810115 TGCCGCCGCCAGCGGGGCCCGGG - Exonic
988505624 5:31820071-31820093 TGCCTCCCCAAGCTGGGGGCTGG + Intronic
990587516 5:57226639-57226661 AGCCTCCGCCTGCTGGGTTCAGG + Intronic
991220854 5:64214328-64214350 TGCTCCTGCCAGCTGAGGGCAGG - Exonic
997229906 5:132234684-132234706 TGCACCCACCAGATGGGTTCAGG - Intronic
998174627 5:139894206-139894228 TGCCCCTGCCCGCTGGGTGCCGG - Intronic
1003562263 6:7190912-7190934 TGCCCCTGCCAACTTGGAGCTGG - Intronic
1006474745 6:34246699-34246721 TGGCTCCCCCTGCTGGGTGCTGG - Exonic
1007094463 6:39204896-39204918 AGCCCCTGCCAGATGGGAGCAGG + Intronic
1007179183 6:39916007-39916029 TGCCCTCCCCAGCTATGTGCAGG + Intronic
1010703259 6:79077610-79077632 TGCCGCCGCCGGCAGGGCGCGGG - Intronic
1017765314 6:157602518-157602540 TGCCACCGGGAGCTGTGTGCAGG + Intronic
1018458122 6:163971237-163971259 TGTCCCCACCAGCTGGGTGGTGG - Intergenic
1019581774 7:1767753-1767775 TCCCCAGGCCAGCTGGTTGCAGG - Intergenic
1020121257 7:5505016-5505038 TGCACCCCCCAGCAGGGTGCAGG - Intronic
1021706110 7:23369418-23369440 TGTCTCCCCCAGCTGGGGGCTGG - Intronic
1022351052 7:29566286-29566308 TGGCCCTTCCATCTGGGTGCCGG + Exonic
1022471805 7:30686210-30686232 TGACCCCATCTGCTGGGTGCTGG + Intronic
1027138270 7:75639379-75639401 CGCCCCCGCCAGCTGATTCCGGG - Intronic
1027488013 7:78786260-78786282 TGGACCCGCCTGCTGGGTGTGGG - Intronic
1029404624 7:100367115-100367137 AACCCCAGCCAGCTGAGTGCTGG + Intronic
1032085234 7:128880267-128880289 TCCTGCCGCCAGCTGGGAGCTGG - Intronic
1033078060 7:138268009-138268031 TCCCCAGTCCAGCTGGGTGCAGG + Intergenic
1034219272 7:149431687-149431709 CGCCCCCGCCCGCTGGGCTCGGG + Exonic
1034448505 7:151125499-151125521 TGGTGCCGCCAGCTGGGGGCAGG + Intronic
1035391807 7:158509176-158509198 TGGTCCCGCCTGCTGGGTGGAGG - Intronic
1035566314 8:643539-643561 TGCCCCTGCCGGCTGGGCCCTGG + Intronic
1035828010 8:2665173-2665195 AGCCCCAGCCACCTGGGGGCGGG + Intergenic
1037896649 8:22660996-22661018 TGCCTCAGCCTGCTGAGTGCTGG + Intronic
1039880212 8:41621003-41621025 GGCCCCAGCCAGCTGGAGGCAGG - Exonic
1045586549 8:103544320-103544342 TGCACCCACCAGCTGAGTTCAGG - Intronic
1048407163 8:134135410-134135432 TGCATCCCCCAGCTGGATGCTGG - Intergenic
1049323723 8:142010975-142010997 TGCCCCTGCCTGCAGGGGGCGGG - Intergenic
1049462514 8:142736654-142736676 TGCCCCATCTAGCTGGGTGCAGG + Exonic
1049725614 8:144144350-144144372 TGCCCAGGCCAGCAAGGTGCAGG + Intergenic
1053434427 9:38066082-38066104 TGTCCTCCCCTGCTGGGTGCTGG - Intronic
1057036794 9:91817232-91817254 TGCCCCTCCCTGCTGGGTCCCGG - Intronic
1057230620 9:93319423-93319445 TGCCCCCGCCAGCTGTGGCCTGG + Intronic
1059912323 9:119058612-119058634 AACCCCCGCCACCTGGGTTCAGG - Intergenic
1060917945 9:127402546-127402568 ACCCCCCGCAGGCTGGGTGCTGG + Exonic
1061194180 9:129098499-129098521 TGCCCCCGCCATCCCTGTGCTGG - Intronic
1061257545 9:129461136-129461158 CGCCCCCGCCGGCTGTCTGCTGG + Intergenic
1061543919 9:131292874-131292896 TGCCCATGGCAGCTGGCTGCTGG - Intronic
1061577292 9:131515027-131515049 TCCCCAGGCCAGCTGGGCGCAGG + Intronic
1061724268 9:132573060-132573082 TGCCCCCGCCTCCTCAGTGCTGG + Exonic
1062234163 9:135500149-135500171 GGACCCCGCCAGCCGGGTGACGG + Intronic
1062429320 9:136519975-136519997 TGCCCCAGCCAGCAGCCTGCTGG - Intronic
1062601579 9:137320756-137320778 AGCCCTGGCCAGCCGGGTGCTGG - Intronic
1197873552 X:131082430-131082452 TGCCCACCTCAGCTGGCTGCCGG + Intronic
1199109682 X:143916126-143916148 GGCTCCAGCCAGCTGGGTGTGGG - Intergenic
1200044366 X:153393230-153393252 TGCCGCCACCACCTGGGTCCAGG + Intergenic
1200133739 X:153864767-153864789 GGCCCCGGCCAGCCGGGTCCAGG - Intronic