ID: 1166857038

View in Genome Browser
Species Human (GRCh38)
Location 19:45787393-45787415
Sequence CCTGATGATCAGAGGCAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166857035_1166857038 -5 Left 1166857035 19:45787375-45787397 CCTTATTAGAATCTAACACCTGA 0: 1
1: 15
2: 121
3: 1513
4: 1553
Right 1166857038 19:45787393-45787415 CCTGATGATCAGAGGCAGAACGG 0: 1
1: 0
2: 8
3: 64
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166857038 Original CRISPR CCTGATGATCAGAGGCAGAA CGG Intronic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
900735214 1:4295412-4295434 CCTGCTGATCAGAGGCTGGAAGG - Intergenic
904553607 1:31342516-31342538 CCTGATGATCTAAGGTGGAACGG - Intronic
904797394 1:33067242-33067264 CCTTTTGAGCAGAGGCATAAGGG - Intronic
905031010 1:34884738-34884760 CCAGGTGCTCAGAGGCAGACGGG - Intronic
905646844 1:39630838-39630860 CCTGAAGATCAGAGGCTCCATGG + Intronic
906089883 1:43169952-43169974 CCTGATGATCTGAGATGGAACGG + Intronic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
907223582 1:52924999-52925021 CTTGAGGAGCTGAGGCAGAAAGG - Intronic
907240827 1:53080143-53080165 TGTGATGATCTGAGACAGAATGG + Intronic
909901422 1:81141305-81141327 CCTGATGATCTGAGGTGGAATGG - Intergenic
910602760 1:89049576-89049598 CCTGATTAGCAGAGGCAGGTGGG - Intergenic
910621088 1:89255548-89255570 CATAATGATCAGATGGAGAAGGG - Intergenic
911719724 1:101177776-101177798 CCTGATCATCTGAGGTGGAACGG + Intergenic
912353248 1:109034683-109034705 CCTGTTGATCTGAGGTAGAATGG + Intronic
915536752 1:156541006-156541028 CCTGCTGATCCCAAGCAGAACGG - Intronic
916015529 1:160746481-160746503 CTTTATGTTAAGAGGCAGAAGGG + Intronic
916735267 1:167601865-167601887 CCTGCAGATCAAAGGCAGAGGGG - Intergenic
916918509 1:169437636-169437658 CCTGCTGATCAGGGGCATAGTGG + Intronic
917241536 1:172954190-172954212 CCTGAGGATGAGGGTCAGAAGGG - Intergenic
918031402 1:180816214-180816236 CCTGATGATCGGAGGTGGAAGGG - Intronic
918265181 1:182835872-182835894 CCTGATGATCTGAGGTGGAACGG - Intergenic
919149356 1:193675774-193675796 CCTGTTTATCAGTTGCAGAATGG + Intergenic
920187208 1:204167183-204167205 CCTGGGGGTCAGAGGCAAAATGG - Intergenic
920187747 1:204172073-204172095 CCTGGGGGTCAGAGGCAAAATGG - Intergenic
921193137 1:212727092-212727114 CCAGTTCACCAGAGGCAGAAGGG + Intronic
921887657 1:220322632-220322654 GCAAATGCTCAGAGGCAGAAAGG - Intergenic
922231940 1:223695168-223695190 CCTTTGGATCATAGGCAGAAAGG + Intergenic
922897920 1:229114852-229114874 CCTGAAGATGAGATGGAGAATGG - Intergenic
923218276 1:231870151-231870173 CCTGATGATCCCAGGCAAAATGG - Intronic
923765508 1:236889356-236889378 CTTGAATATCAGAGGCAGAAAGG - Intronic
924228146 1:241939918-241939940 CCTCATAATCAGAACCAGAAGGG - Intergenic
1063819608 10:9819480-9819502 CCTGATGATCCAAGGTGGAACGG - Intergenic
1066530636 10:36334724-36334746 CCAGAAGATCAGAAGCAAAATGG + Intergenic
1068279866 10:54854667-54854689 CCTGATGATCAGCTGCAGAGAGG - Intronic
1069136497 10:64773113-64773135 CCTGATGATCTGAGGTGGAACGG + Intergenic
1069273199 10:66556701-66556723 GCTGGTTATCAGGGGCAGAAAGG + Intronic
1069572333 10:69501929-69501951 CCTGATGATCTGAGGTGGAATGG + Intronic
1069663501 10:70139416-70139438 TCTGAAGACCAGAGACAGAAGGG - Exonic
1070018519 10:72559962-72559984 CCTGATGATCTGCGGTGGAACGG + Intronic
1071315191 10:84388719-84388741 CCTGATGATCTGAGGTGGAAGGG - Intronic
1072914105 10:99526694-99526716 CCTGAGGGTCAGAAGCAGAGGGG + Intergenic
1075141584 10:119842128-119842150 CCTGATGTTCTGAGGTGGAACGG + Intronic
1075300680 10:121321243-121321265 CCTGCCCCTCAGAGGCAGAAAGG + Intergenic
1075636339 10:124033405-124033427 CCTGAGGATCAGGTGCAGAACGG + Intronic
1076431264 10:130404245-130404267 TCCCATGATGAGAGGCAGAAGGG + Intergenic
1077028728 11:453659-453681 CTTGCTGGTCAGAGCCAGAAGGG + Intronic
1077126104 11:937965-937987 CCAGGCAATCAGAGGCAGAAAGG - Intronic
1077981821 11:7308679-7308701 CCAGAAGATGAGAGGGAGAAAGG - Intronic
1079755239 11:24251007-24251029 CCTGATGATCATAGACATTAGGG + Intergenic
1080723645 11:34873241-34873263 CTTGATGATCTGAGGTGGAACGG + Intronic
1080788721 11:35499934-35499956 CAGGATGGTCAGAGTCAGAAAGG + Intronic
1084459895 11:69290896-69290918 CCAGTTGCTCACAGGCAGAAGGG + Intergenic
1084608442 11:70185925-70185947 CCGGATGAGCACCGGCAGAAGGG + Intronic
1085413644 11:76306379-76306401 CCTGAGCATCAGATGCAGGAGGG + Intergenic
1086154376 11:83649339-83649361 CCTGGTGCTCAAAGGGAGAAAGG + Intronic
1086911671 11:92479573-92479595 CCTTATCTACAGAGGCAGAATGG - Intronic
1087878291 11:103385311-103385333 CATGATGAACAGAGAGAGAAAGG - Intronic
1089605970 11:119641518-119641540 CCTGAGGATGAGAGGAAGCAGGG - Intronic
1091871835 12:3898197-3898219 CCTCATGCTCTGAGGCAGATGGG - Intergenic
1091995408 12:4989023-4989045 GCTGATAGGCAGAGGCAGAAAGG - Intergenic
1092833952 12:12470532-12470554 CCTGATGATCTGAGATGGAACGG + Intergenic
1093458961 12:19391279-19391301 CTTGAGGATTGGAGGCAGAAGGG + Intergenic
1093909812 12:24733906-24733928 CCTGATGCTGATTGGCAGAATGG - Intergenic
1095927219 12:47591209-47591231 CCTGAGGCTCAGAGGCATCAGGG - Intergenic
1095989923 12:48027554-48027576 CCTCATTAGCAGAGACAGAAAGG + Intergenic
1097642315 12:62197128-62197150 CCTGATGATCTGAGGTGGGATGG + Intronic
1098031638 12:66260862-66260884 CCTGATGACCTGAGGTGGAACGG + Intergenic
1098244589 12:68503184-68503206 CCTGATGATCTGAGGTGGAACGG + Intergenic
1098702401 12:73645619-73645641 CCTGATGATCAGAGGGTGTGTGG + Intergenic
1099341937 12:81448424-81448446 CCTGAAGATGAAAGGCTGAAAGG - Intronic
1100441056 12:94617228-94617250 CCTGATGAACAGAGAGAGAAAGG + Intronic
1101931442 12:109017303-109017325 CCTGAAGATCTGAGGTGGAATGG + Intronic
1102872251 12:116423135-116423157 CCTGATGACCAGAGGCACCCCGG - Intergenic
1103253272 12:119519298-119519320 CCTGATGATCAGAAGCAGTTAGG + Intronic
1106881606 13:34138070-34138092 CCTCATCAGCAGAGGCAGACAGG - Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1108418914 13:50228831-50228853 CCTGCTGTTCAAAGGCAGATGGG + Intronic
1108583480 13:51847401-51847423 CCTGATGATCTGAGGTTGAACGG + Intergenic
1108936693 13:55890918-55890940 TTTGAGGCTCAGAGGCAGAAGGG - Intergenic
1112053181 13:95664427-95664449 CCTGATGATCTGAGGTGGAACGG - Intergenic
1112641230 13:101277873-101277895 CCACATGAGCAGAGGCAGAGAGG - Intronic
1113878299 13:113608179-113608201 CCTGATGGGCAGAGACAGAGTGG - Intronic
1117045294 14:51807491-51807513 ACTAATGATCAGAGGGAGAGAGG + Intergenic
1117157845 14:52958413-52958435 CCTGATGATCTGAGATGGAACGG + Intergenic
1117876978 14:60262708-60262730 CCACATGTTCAGAGGTAGAAGGG - Intronic
1119151866 14:72367895-72367917 TCAGAAGATCAGAGTCAGAATGG - Intronic
1119540368 14:75434214-75434236 GCTGACGATCTAAGGCAGAAAGG - Intronic
1120727893 14:87966306-87966328 CCTGATCATCTGAGAAAGAATGG - Intronic
1121038548 14:90726660-90726682 CCTGAGACTCAGAGGAAGAAAGG + Intronic
1122065061 14:99167259-99167281 CCAGCTGTTCAAAGGCAGAATGG + Intergenic
1122243917 14:100387764-100387786 CCTTATTCTCAGAGGCAGGAGGG - Intronic
1122449843 14:101796839-101796861 CTTGAGGAGCAGAGGCAGCAGGG - Intronic
1124064122 15:26323580-26323602 CCTGGTGGTGAGTGGCAGAAGGG - Intergenic
1125117205 15:36108669-36108691 GATGATGATCATAGTCAGAATGG + Intergenic
1125207241 15:37167565-37167587 CCTGGTGATCTGAAGTAGAATGG + Intergenic
1125704370 15:41720125-41720147 CTTGAAGAACAGTGGCAGAATGG + Intronic
1125761879 15:42102423-42102445 CCTGGTGAGGAGAGGCAGAGGGG - Intergenic
1127285184 15:57526567-57526589 CATGCTTATCAGAGGTAGAATGG - Intronic
1127378825 15:58410304-58410326 CCTCAGGATCAGAGGCAGTGAGG - Intronic
1127473512 15:59311268-59311290 CCTGATGATGTGAGGTGGAACGG - Intronic
1128723473 15:69970528-69970550 CCTGAGGATAAGCCGCAGAAAGG - Intergenic
1129233803 15:74211740-74211762 ACTGATGGACAGGGGCAGAAAGG - Intronic
1130146724 15:81280164-81280186 CCTGAATGTCAGAGGTAGAAAGG - Intronic
1130691963 15:86089458-86089480 CCTCCTGATCAGAATCAGAATGG - Intergenic
1131385948 15:92007531-92007553 CCTCATGGTGAGTGGCAGAAGGG + Intronic
1131668877 15:94598296-94598318 CCAGAGGATCAGAGGCTGCATGG + Intergenic
1131748318 15:95474894-95474916 CCTGATGATCAGGGACACAAAGG - Intergenic
1135100466 16:19600743-19600765 GCTGATGATGAGAGACAGTAGGG + Intronic
1135839508 16:25862059-25862081 CCTGATGATTTGAGGTGGAACGG - Intronic
1136093580 16:27937850-27937872 CCTGGTAATCAGAGACAGAGAGG - Intronic
1137639696 16:50017781-50017803 CCTGATGATCTGAGGTGGAACGG + Intergenic
1137876602 16:52002591-52002613 CCTGATGTTCAAAGACATAATGG - Intergenic
1138267695 16:55671705-55671727 CCTGATGACCTGAGGTGGAACGG + Intronic
1140106338 16:71963963-71963985 CCTGATGATGAAAGGCAGATGGG - Intronic
1140418639 16:74797360-74797382 CCTGTTGATCTGAGGTGGAACGG - Intergenic
1140539101 16:75739438-75739460 CCTGAAGGTCACAGGGAGAATGG - Intronic
1140547595 16:75826571-75826593 CCTGAAGGTCACAGGGAGAATGG - Intergenic
1140652237 16:77100665-77100687 CCTGACGATCTGAGGTGGAACGG + Intergenic
1140992794 16:80230664-80230686 CCTGGTGAGCAGAGGCAGAGTGG + Intergenic
1141119954 16:81345874-81345896 TCTGATGATCTGAGGTGGAACGG - Intronic
1141232226 16:82179407-82179429 CCTGATGCCCAGAGGCAGACAGG - Intergenic
1141737036 16:85860744-85860766 CCTGAGGATCAGTGGGAGAGGGG + Intergenic
1144013931 17:11175761-11175783 GCTGATGTTCAAAGGCAAAAGGG - Intergenic
1144445239 17:15321356-15321378 CCAGATGGTTGGAGGCAGAAGGG + Intronic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1145234562 17:21199643-21199665 CCTGCAGAACAGAGGCAGAAAGG + Intronic
1146393333 17:32442870-32442892 CCTGATGATCTGAGGTGGAACGG + Intergenic
1147175850 17:38655763-38655785 CCTGGAGGTCAGAGGGAGAAGGG - Intergenic
1147264654 17:39227398-39227420 TCTGCTGGTCAGAGCCAGAAGGG - Intergenic
1147769769 17:42859471-42859493 CCAGATGAGGGGAGGCAGAATGG + Intergenic
1148782063 17:50128135-50128157 CTTCATTCTCAGAGGCAGAAAGG - Intronic
1149414324 17:56443165-56443187 ACAGATGATAAGAGGCATAATGG - Intronic
1150281448 17:63931584-63931606 CATGAGGGTCAAAGGCAGAAAGG - Intronic
1151374624 17:73678269-73678291 CCTCAGTATCAGAGGAAGAAGGG + Intergenic
1153956349 18:10099659-10099681 CCTGATGATCTGAGGTGGAATGG - Intergenic
1155401852 18:25447986-25448008 CCTGATGATCTGAGGTGGAACGG + Intergenic
1155702208 18:28760637-28760659 CCTGATGATCTGATGTGGAACGG + Intergenic
1155908304 18:31478836-31478858 CCTGATGATCTGAGGTAGAACGG - Intergenic
1155923237 18:31626693-31626715 CCTGATGATCTGAGGTGGAATGG + Intronic
1156276155 18:35584688-35584710 CCTGATGATCTGAGGTGTAACGG - Intronic
1156505612 18:37589215-37589237 CCTGAAGCTCAGAGGCCGTATGG + Intergenic
1157884664 18:51354980-51355002 CCTTATAAACAGAGGCTGAAGGG + Intergenic
1158133890 18:54184379-54184401 CCTAATGATCTGAGGTGGAATGG + Intronic
1158865104 18:61631054-61631076 CCTGATGATCTGAGGTGGAACGG - Intergenic
1158900471 18:61957555-61957577 CCTGGGGATCAGTGGCACAAGGG - Intergenic
1158910533 18:62056953-62056975 CCTGATGATCTGAGGTAGAATGG + Intronic
1158940908 18:62405339-62405361 CCTGATGATCTGCGGTGGAAAGG - Intergenic
1160664780 19:320690-320712 CCTGATGATCTGAGGTGGAACGG + Intronic
1161137885 19:2631099-2631121 CATGAAGACCAGAGGAAGAATGG + Intronic
1161270094 19:3385029-3385051 CCTGCTGAGCAGAGGCGGGAGGG - Intronic
1161824129 19:6551234-6551256 CCTGACGACCAGCTGCAGAAAGG - Intergenic
1162323671 19:9985934-9985956 CCTGGAGGTCAGAGGCGGAAAGG + Intronic
1164432209 19:28198326-28198348 CCTGAAGTTCAGCAGCAGAAGGG - Intergenic
1165268419 19:34681554-34681576 CCTGATGATCTGAGGTAGAACGG - Intronic
1165938401 19:39403202-39403224 CCTGAGGATCTGAGGGAGGAGGG + Intergenic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1166857038 19:45787393-45787415 CCTGATGATCAGAGGCAGAACGG + Intronic
1166986930 19:46666286-46666308 CCTGATGATCATAGGCAATAGGG + Intergenic
927005298 2:18842391-18842413 CCTGATTCTCAAAGGCAGAATGG + Intergenic
927577836 2:24215168-24215190 ACTGATGAGCAGAAGAAGAAAGG - Intronic
927646001 2:24877297-24877319 CCTGCTGACCAGAGGCTGAAGGG - Intronic
927841665 2:26448933-26448955 CCTGAGGAGCAGAGTCAGGATGG + Intronic
928084813 2:28339395-28339417 ACTGATCATCACAGCCAGAAGGG + Intergenic
929254869 2:39799307-39799329 CCTGATGATCTGAGGTGGAACGG + Intergenic
929353979 2:40996867-40996889 CCTGATGATCGGAGGTGAAACGG - Intergenic
929395640 2:41519009-41519031 TCTGATGATTACAGGCACAAAGG + Intergenic
929453415 2:42050832-42050854 CCTGATGGTCAGAAGATGAATGG - Intronic
929871209 2:45760847-45760869 CCTGGTGTCCAGAGGCATAAAGG + Intronic
930365016 2:50428600-50428622 CCTTATGATTAGAGGCGGGACGG + Intronic
930606134 2:53495374-53495396 CCTGATGCTCAGAGTGAGAGAGG - Intergenic
931296055 2:60926991-60927013 CCAGAAGAGCAGAGGCAGAGTGG - Exonic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
935956022 2:108377420-108377442 TCTGATTATCAGGGGCAGAATGG + Intergenic
936984217 2:118292685-118292707 ACTGATTATCAGAGGCAAAGAGG - Intergenic
939227057 2:139377590-139377612 CCTGATGTCCAAGGGCAGAAGGG + Intergenic
939340111 2:140884087-140884109 ACTGCTGATCACAGGCACAAAGG - Intronic
940828625 2:158442547-158442569 CCTGATGAGAAGAGGAAGACTGG - Intronic
941230335 2:162904048-162904070 CCTGATGATCGGAGGTGAAATGG + Intergenic
941607760 2:167621468-167621490 TCTTATGATTAGTGGCAGAAAGG - Intergenic
941753187 2:169155763-169155785 ACTACTGATCACAGGCAGAAAGG - Intronic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
944969105 2:204971180-204971202 CCTGAAGATCAGCGCCATAAAGG - Intronic
945102080 2:206271499-206271521 ACTGCTGATCTGATGCAGAATGG + Intergenic
946394474 2:219436210-219436232 GCTGAGGGTCTGAGGCAGAAGGG + Intronic
946462090 2:219877840-219877862 CCTGCAGCTCAGAGGCAGAGAGG - Intergenic
947747924 2:232518896-232518918 CCTGAAGACCAGAGGCAGGAGGG + Intergenic
947829074 2:233126013-233126035 CCTGGTGACCAGAGGGAGATGGG + Intronic
948159312 2:235811263-235811285 CCTGGACATCAGAGGCAGGAGGG - Intronic
948271162 2:236674244-236674266 CCTGATGATCTGAGGTGGAACGG - Intergenic
1168796295 20:611999-612021 CCTGAGGGTCAGAAGCAGAGAGG - Intergenic
1170195898 20:13689196-13689218 CCTGATGATCTGAGGTGAAACGG + Intergenic
1170614973 20:17941147-17941169 CCTGATGATCTGATGTGGAATGG - Intergenic
1171500249 20:25587444-25587466 TGTGAGGATCAGAGGCAAAATGG + Intergenic
1172996268 20:39072401-39072423 CCTGAGGGTGAGAGGAAGAAGGG - Intergenic
1173437147 20:43043610-43043632 TGTGAAGCTCAGAGGCAGAAAGG - Intronic
1174128644 20:48326664-48326686 CCTGCTGAGCACAGGCAGATGGG + Intergenic
1174707190 20:52669076-52669098 CATGATGCTCAGAAGCACAAAGG - Intergenic
1175742338 20:61428625-61428647 GCTGATGATAGGAGGCAGAGTGG + Intronic
1176240785 20:64074975-64074997 CCAGGGGAGCAGAGGCAGAAGGG - Intronic
1179477321 21:41655732-41655754 GGTGATGATCAGGGGCAGAGGGG - Intergenic
1179910161 21:44443212-44443234 CTTGAAGCTCAGAGGCAGCAGGG + Intergenic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1182395212 22:30030685-30030707 CCTGATGTTTAGAGGCGGAAGGG + Intronic
1182773175 22:32810626-32810648 CCTCATGGGCAGAGGCAGAGGGG - Intronic
1183663824 22:39236014-39236036 CCTGATGATCAGGAGCACAAAGG + Intronic
1184068068 22:42131313-42131335 CCTGATGATGAGTGGCATCATGG + Intergenic
1184070803 22:42144986-42145008 CCTGATGATGAGTGGCATCATGG + Intergenic
949800430 3:7897993-7898015 CCTGATGATCCGAGGTAGAATGG + Intergenic
950437460 3:12988942-12988964 ACTGAGGATCAGAGACAGGAAGG + Intronic
950839913 3:15957947-15957969 ACTGATGAACAGAGGCCCAAAGG - Intergenic
952052246 3:29398394-29398416 CCTGATGACCAGAGAGAAAAAGG - Intronic
952157391 3:30657945-30657967 CCTTAAGATCAGAGGCAAACAGG - Intronic
953248991 3:41226020-41226042 CCTGATTATCTGAGGTGGAATGG - Intronic
953849818 3:46456957-46456979 CCTGATGATCAGAGGTGGAACGG - Intronic
956338720 3:68195448-68195470 ACTGATGTTTAGAGACAGAATGG - Intronic
956404751 3:68916747-68916769 CTTGAGGATAAGAGGCAGAAGGG - Intronic
959255498 3:104006739-104006761 GCTGATGATAAGAGATAGAAAGG + Intergenic
960549881 3:118963296-118963318 CCAGAATATCAGAGGTAGAATGG - Intronic
961473570 3:127133665-127133687 CCAGAGGGTCAGAGTCAGAAAGG - Intergenic
961748047 3:129078463-129078485 ACTTATGGTCAGAGGAAGAAAGG + Intergenic
962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG + Intronic
962264484 3:133935397-133935419 CCTGCTGCTCAGAGACAGAGGGG - Intronic
962286531 3:134090978-134091000 CCTGATGATCTGAGGTGGAACGG - Intronic
962663509 3:137629588-137629610 CCTGATCATGAGGTGCAGAATGG + Intergenic
963017533 3:140840131-140840153 CCTGTTGATGAGATGGAGAAAGG + Intergenic
963019004 3:140854146-140854168 ACTGATGATTAGATGCATAATGG + Intergenic
964209640 3:154212642-154212664 CCTGATGATCTGAGGTGAAATGG - Intronic
964357233 3:155862002-155862024 CTTGATGGTCAGAGGCAAGATGG - Intergenic
967234914 3:187374695-187374717 CCTGATCATCAGAGGGAAATAGG - Intergenic
967293377 3:187943289-187943311 CCTGATGGGCAGGGACAGAAGGG - Intergenic
967602122 3:191402268-191402290 CCTGCTGATCTGAGGTGGAACGG + Intergenic
969691277 4:8705467-8705489 CCTGGTGGTCAGAGCTAGAAGGG + Intergenic
971212957 4:24637429-24637451 CCTGAGGATCTGAGGTGGAATGG + Intergenic
971328152 4:25661241-25661263 CTTTATGCTCAGAGGCATAAAGG + Intronic
973664585 4:53145083-53145105 CCTGATGATGTGAGGTGGAACGG + Intronic
975226364 4:71877052-71877074 CCTGATGAACATAGGTACAAAGG - Intergenic
975610706 4:76199944-76199966 CCTGAGGATCAGAAATAGAAGGG - Intronic
975791588 4:77958736-77958758 CCTGATGAACAGAGGCACCTTGG + Intergenic
976181538 4:82404305-82404327 CCTGATGGTCTGAGGCTGATTGG - Intergenic
977527592 4:98163860-98163882 CCTGCTGATCAGGGGCATAGTGG - Intergenic
977752385 4:100624871-100624893 GCAGATGATCAGATGCAGGAGGG + Intronic
978605354 4:110473656-110473678 CCAGATGAGCAGAGGTAGAAGGG - Intronic
978841381 4:113217549-113217571 CCTGATGATTTGAGGCAGAACGG - Intronic
979665686 4:123308578-123308600 CCTGATGATCTGAGATGGAACGG + Intronic
980306260 4:131064925-131064947 CGTGATGATCAGCTGCAAAAAGG - Intergenic
980711385 4:136573110-136573132 CCTGATGACCTGAGGTAGAACGG + Intergenic
980787248 4:137571694-137571716 CCTGAAGAACACACGCAGAATGG - Intergenic
981261748 4:142729053-142729075 CCTGATGATCTGAGGTAGAATGG - Intronic
983143751 4:164187311-164187333 CCTCTGGATCAGAGGCAGATTGG + Intronic
983330134 4:166316064-166316086 CCTGATGATCTGAGGTGGAACGG + Intergenic
983967933 4:173836185-173836207 CCTGAACATTAGAGGCTGAATGG - Intergenic
985339465 4:188933935-188933957 CCTGCTGATCAGGGGCATAGTGG - Intergenic
987010072 5:13753908-13753930 CCTGATAATAAAAGGCATAAAGG + Intronic
990443132 5:55866404-55866426 CCTGATGATATGAGGTAGAACGG - Intronic
990510173 5:56482286-56482308 CCTGATGCTCAGTGGCAGTTTGG + Intergenic
992553640 5:77882941-77882963 CATGATCAGCACAGGCAGAAAGG - Intergenic
993011934 5:82492755-82492777 TATGATGCTGAGAGGCAGAAGGG - Intergenic
993085852 5:83363096-83363118 CAGGATGCTCAGAGGCACAAAGG + Intergenic
993970587 5:94414926-94414948 CCTGATGATCTGAGGTGGAACGG + Intronic
994708866 5:103241481-103241503 CCTGATGGTCTGAGGTGGAACGG + Intergenic
995158535 5:108945576-108945598 CCTGATGATAAGGAGGAGAAAGG - Intronic
995164325 5:109021120-109021142 CCTCATGATCAGATCCAAAAAGG + Intronic
995490608 5:112687480-112687502 CCTGCTGGCCAGAGGCAGAAAGG - Intergenic
995651743 5:114377301-114377323 CCTTAGGATCAGAGGCAGAGTGG - Intronic
997318001 5:132954216-132954238 CCTGATGATCTGAGGTGAAATGG - Intronic
998072735 5:139211036-139211058 CCTGATGATCTGAGGGGGAACGG + Intronic
1001487160 5:172127887-172127909 CCTGATGTTCTGAGCCAGCAAGG - Intronic
1001538130 5:172514086-172514108 CCTGATGATCTGAGGTGGAACGG + Intergenic
1005814239 6:29538067-29538089 CCTGATGATCAAAGTCAGGCTGG + Intergenic
1006730654 6:36233741-36233763 CCTGAAGAGCAGAAGCAGAGGGG + Intergenic
1006739071 6:36294393-36294415 CCTGGTGGTGAGAGGCAGGAGGG + Exonic
1007192111 6:40028354-40028376 CCAGAATATCATAGGCAGAATGG - Intergenic
1007752468 6:44078713-44078735 CCTGATTAGCAGAGCCAGACAGG + Intergenic
1008508712 6:52256179-52256201 CCTGATGATCTGAGGTGGAACGG + Intergenic
1009196751 6:60695573-60695595 CCTGATGACCAGCTGCAGAAAGG + Intergenic
1010239991 6:73606396-73606418 CCTCATTATCTGAGGCACAAAGG + Intronic
1011029784 6:82909360-82909382 CCTGAAAATCACTGGCAGAAAGG - Intronic
1011697430 6:89924878-89924900 CCTGATGATCTGAGGTGGAACGG - Intergenic
1012406712 6:98909204-98909226 CCTGAAGATCACTGGCTGAAGGG + Intronic
1012979859 6:105818062-105818084 CCTGATGATCTGAGGTGGAACGG + Intergenic
1013372309 6:109481926-109481948 TTTGAGGATCAGAGGAAGAAAGG - Exonic
1013594694 6:111649934-111649956 CCTGATGATCTGAGGTGGAATGG - Intergenic
1015016385 6:128418543-128418565 CCTGATGACCTGAGGTGGAACGG + Intronic
1016543153 6:145189623-145189645 TCTGATCATCTGTGGCAGAAAGG - Intergenic
1018117432 6:160600978-160601000 CACGATGCTCAGATGCAGAATGG - Exonic
1018335625 6:162785617-162785639 CCTGATGATCAAAGGTAGAACGG - Intronic
1019953697 7:4394745-4394767 CCTAATGATAATAGGCAGATAGG - Intergenic
1020558438 7:9698595-9698617 GCTGTTGCTGAGAGGCAGAAAGG - Intergenic
1022484656 7:30769182-30769204 CCTGATGATCTGAGGTGGAACGG - Intronic
1026182354 7:68053006-68053028 CCTGATGATCTGAGGTGGAACGG - Intergenic
1026189030 7:68107663-68107685 CCGAAGGATCAGAGGAAGAAAGG + Intergenic
1026946272 7:74318195-74318217 GCAAATGCTCAGAGGCAGAAAGG + Intronic
1030382276 7:108825833-108825855 CTTCATGATCTTAGGCAGAAGGG - Intergenic
1030948809 7:115763365-115763387 CCTGATGATCTGAGGTGGAATGG - Intergenic
1032743121 7:134759501-134759523 CCTGAGGACAAGAGGCAGCAAGG + Intronic
1033250956 7:139758703-139758725 CCTGATGATCTGAGGTGGAATGG + Intronic
1036792434 8:11730376-11730398 ACAGATCATCAGAGGTAGAAGGG - Intronic
1036944796 8:13084976-13084998 CCTGTGGATCAGAGCCAGTAAGG + Exonic
1037203188 8:16282803-16282825 CTTGAAGACCAAAGGCAGAATGG + Intronic
1037824268 8:22151675-22151697 ACTGAAGACCAGAGGGAGAAGGG + Intronic
1038060584 8:23907902-23907924 AATGATGGTCAGAGCCAGAAAGG - Intergenic
1038288665 8:26228648-26228670 GCTGATAAGCAGAGGCACAACGG - Intergenic
1038675002 8:29615385-29615407 CATGACTATCAGAGGCTGAATGG - Intergenic
1038729762 8:30116404-30116426 CCTGATGATCTGAGGTGGAACGG - Intronic
1041371466 8:57165142-57165164 GCTGTGGATCAGAGGCAGGAGGG - Intergenic
1042623185 8:70728323-70728345 CCTGCTGATCAGGGGCATAGTGG + Intronic
1042797993 8:72685632-72685654 CCTGAAGATGAGTGGCAGAGCGG + Intronic
1043381405 8:79706005-79706027 CCTGATCATCAAAGCCAGAAGGG + Intergenic
1043794599 8:84520767-84520789 CTTGATGATCTGAGGTGGAATGG + Intronic
1045148800 8:99379152-99379174 CCTGATCATCTGAGGTGGAATGG + Intronic
1048141713 8:131801421-131801443 CCTGTAGATCGGAGCCAGAAAGG - Intergenic
1048426581 8:134329125-134329147 GCTGAGGGTCAGAGGAAGAAAGG - Intergenic
1049204088 8:141355319-141355341 ACTGAGGCTCAGAGGGAGAAAGG - Intergenic
1049994030 9:1017739-1017761 CCTGATTTTCTGTGGCAGAAGGG + Intergenic
1050658998 9:7862525-7862547 CCTGCTGATCTGAGGTGGAACGG + Intronic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1052879610 9:33593269-33593291 TCAGAGGCTCAGAGGCAGAAGGG + Intergenic
1053097276 9:35339492-35339514 CCTGTAGAACAGTGGCAGAAGGG + Intronic
1053496371 9:38550963-38550985 TCAGAGGCTCAGAGGCAGAAGGG - Intronic
1053738059 9:41114068-41114090 CCTAATATTCAGAGGCAGAGAGG - Intergenic
1054690288 9:68317251-68317273 CCTAATATTCAGAGGCAGAGAGG + Intergenic
1056756494 9:89385180-89385202 ACTGATCCTCAAAGGCAGAAGGG - Intronic
1060515509 9:124263313-124263335 CCTGAGGCTCAGAGGGAGCAAGG + Intronic
1060737234 9:126073758-126073780 ACTGAGGACCAGAGGGAGAAGGG + Intergenic
1061499110 9:130992128-130992150 CCTGGCGAGAAGAGGCAGAAGGG + Intergenic
1062593617 9:137287275-137287297 GCTCATCCTCAGAGGCAGAAGGG - Intergenic
1185488376 X:500087-500109 CCTGTTAATCCCAGGCAGAATGG + Intergenic
1188107408 X:26161017-26161039 CCTGAGGAACAGAGGCATCACGG - Intergenic
1188313523 X:28646159-28646181 CCTGATGTTCTGAGGTGGAACGG - Intronic
1188545998 X:31307962-31307984 CCTGATGATCTGAGGTGGAACGG - Intronic
1189344207 X:40228204-40228226 CCTGGTGATCTGAGGTGGAACGG - Intergenic
1189503279 X:41584523-41584545 CCTGATAATCTGAGGTGGAACGG - Intronic
1191910833 X:66147643-66147665 AATGTTGATGAGAGGCAGAATGG - Intergenic
1192248398 X:69391437-69391459 CCAGCTAATCAGAGGCAGAGTGG + Intergenic
1192794770 X:74417890-74417912 CTTGATGATCTGAGGTGGAACGG - Intergenic
1193247723 X:79249079-79249101 CCAGATGATCACAGGTAGAATGG + Intergenic
1195511206 X:105717309-105717331 CCTGATTATCAGTGGGAGACAGG - Intronic
1196192132 X:112805854-112805876 CATCAGGATCAGAGGAAGAAAGG + Intronic
1196902904 X:120403308-120403330 CCTGATGATCCGAGGTGGAACGG - Intergenic
1197784214 X:130184657-130184679 CGTGATGCTGAGAGGCAGCAGGG + Exonic
1198617659 X:138477357-138477379 CCTGATAATCTGAGGTGGAACGG - Intergenic
1198768699 X:140105529-140105551 TGAGATGACCAGAGGCAGAAAGG - Intergenic
1199434191 X:147794760-147794782 GCTAATCATCAGAGGCAGTATGG + Intergenic
1199686046 X:150266565-150266587 CCAGAAGAGCAGAGGCAGTAAGG - Intergenic
1200226742 X:154421632-154421654 AGTGATGTTGAGAGGCAGAAAGG - Exonic
1202051051 Y:20781187-20781209 CTTGAGGGTCAGAGGAAGAACGG - Intergenic