ID: 1166859063

View in Genome Browser
Species Human (GRCh38)
Location 19:45799253-45799275
Sequence CTCTGCCCTGCTGCGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166859063_1166859069 -3 Left 1166859063 19:45799253-45799275 CCCTGTCACGCAGCAGGGCAGAG No data
Right 1166859069 19:45799273-45799295 GAGGGCTGCCAGGTGCCTGCGGG 0: 1
1: 0
2: 8
3: 38
4: 409
1166859063_1166859078 19 Left 1166859063 19:45799253-45799275 CCCTGTCACGCAGCAGGGCAGAG No data
Right 1166859078 19:45799295-45799317 GGGAAGGCTGAAGGACTGTGGGG 0: 1
1: 0
2: 4
3: 60
4: 388
1166859063_1166859076 17 Left 1166859063 19:45799253-45799275 CCCTGTCACGCAGCAGGGCAGAG No data
Right 1166859076 19:45799293-45799315 GGGGGAAGGCTGAAGGACTGTGG 0: 1
1: 0
2: 2
3: 43
4: 448
1166859063_1166859071 -1 Left 1166859063 19:45799253-45799275 CCCTGTCACGCAGCAGGGCAGAG No data
Right 1166859071 19:45799275-45799297 GGGCTGCCAGGTGCCTGCGGGGG 0: 1
1: 0
2: 4
3: 43
4: 400
1166859063_1166859068 -4 Left 1166859063 19:45799253-45799275 CCCTGTCACGCAGCAGGGCAGAG No data
Right 1166859068 19:45799272-45799294 AGAGGGCTGCCAGGTGCCTGCGG 0: 1
1: 0
2: 1
3: 44
4: 434
1166859063_1166859070 -2 Left 1166859063 19:45799253-45799275 CCCTGTCACGCAGCAGGGCAGAG No data
Right 1166859070 19:45799274-45799296 AGGGCTGCCAGGTGCCTGCGGGG 0: 1
1: 0
2: 3
3: 31
4: 303
1166859063_1166859074 10 Left 1166859063 19:45799253-45799275 CCCTGTCACGCAGCAGGGCAGAG No data
Right 1166859074 19:45799286-45799308 TGCCTGCGGGGGAAGGCTGAAGG 0: 1
1: 0
2: 0
3: 20
4: 236
1166859063_1166859072 3 Left 1166859063 19:45799253-45799275 CCCTGTCACGCAGCAGGGCAGAG No data
Right 1166859072 19:45799279-45799301 TGCCAGGTGCCTGCGGGGGAAGG 0: 1
1: 0
2: 2
3: 38
4: 316
1166859063_1166859077 18 Left 1166859063 19:45799253-45799275 CCCTGTCACGCAGCAGGGCAGAG No data
Right 1166859077 19:45799294-45799316 GGGGAAGGCTGAAGGACTGTGGG 0: 1
1: 0
2: 5
3: 26
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166859063 Original CRISPR CTCTGCCCTGCTGCGTGACA GGG (reversed) Intronic
No off target data available for this crispr