ID: 1166862888

View in Genome Browser
Species Human (GRCh38)
Location 19:45819937-45819959
Sequence GGCCTGCAGCGTGCACGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166862886_1166862888 -5 Left 1166862886 19:45819919-45819941 CCAGCTGGAGGGTTGTCTGGCCT 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1166862888 19:45819937-45819959 GGCCTGCAGCGTGCACGCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166862888 Original CRISPR GGCCTGCAGCGTGCACGCCT GGG Intronic
900549058 1:3244763-3244785 GGACTGCAGTGTGCACACCCAGG - Intronic
902161712 1:14535713-14535735 GGACTGCAGCTTGCATGCCACGG + Intergenic
902472251 1:16657101-16657123 GGCCTGCAGCTTGCGCCACTAGG + Intergenic
902486552 1:16750345-16750367 GGCCTGCAGCTTGCGCCACTAGG - Intronic
913212486 1:116593130-116593152 GGCCCTCAGGGTGCACGCCATGG + Intronic
913963181 1:143354454-143354476 GGCCTGGGCCGTGCACGCCGCGG + Intergenic
914057537 1:144180040-144180062 GGCCTGGGCCGTGCACGCCGCGG + Intergenic
914121609 1:144786326-144786348 GGCCTGGGCCGTGCACGCCGCGG - Intergenic
915558538 1:156673567-156673589 GGCTTGCTGCCTGCAGGCCTGGG - Intronic
921472741 1:215567787-215567809 GGCTTGCAGCGGGGATGCCTTGG + Intronic
1062997721 10:1882371-1882393 GGCGAGCACCGTGCACGGCTGGG - Intergenic
1064229588 10:13518278-13518300 AGCCTGCAGCCTGCTCGCCACGG - Intronic
1065819541 10:29512761-29512783 GGCCAGCAGCCTGCACACCCAGG - Exonic
1066370742 10:34815864-34815886 AGCCTGCAGCTTGCTCGGCTGGG + Intergenic
1066997622 10:42578304-42578326 GGCCTGCAGCATGGCTGCCTCGG + Intronic
1067414054 10:46090671-46090693 GGCCTGTGGCCTGCACCCCTTGG + Intergenic
1067687660 10:48476809-48476831 GGCCTGCTGGGTGCAGGTCTTGG + Intronic
1071478342 10:86043444-86043466 GGCCTGCAGGATGCACTCCCAGG - Intronic
1074141932 10:110680664-110680686 GGCGGGGAGGGTGCACGCCTGGG + Intronic
1076898446 10:133325484-133325506 GGGCTGCAGCGAGGGCGCCTGGG + Exonic
1078729779 11:13963905-13963927 GGCCTCCAGGGAGCAGGCCTCGG - Intronic
1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG + Exonic
1082050464 11:47766943-47766965 GGCCCGCAGCAGGCAGGCCTCGG + Intronic
1083679533 11:64344790-64344812 GGCCTCCAGCTTGCGGGCCTGGG - Exonic
1091405855 12:209113-209135 GGCCTGCAGCTTCCACCCCCAGG + Intronic
1097918208 12:65042132-65042154 GACCTGCAGCCTGGACACCTAGG - Intergenic
1100260713 12:92929532-92929554 AGGCTGCGGAGTGCACGCCTGGG + Intergenic
1105292396 13:19061352-19061374 GGCATGAAGCGTTCAGGCCTTGG + Intergenic
1107978561 13:45713513-45713535 CTCCTGCAGCATGCACTCCTTGG - Exonic
1113546326 13:111153850-111153872 GGCCGGCAGCGGGGACGCCGCGG - Intronic
1115145697 14:30223576-30223598 GGTCTGCAGTCTGCACACCTGGG - Intergenic
1116354801 14:43914667-43914689 GGCCTGCAGTGTGCACTGCCTGG - Intergenic
1116898914 14:50343284-50343306 GGCCTGCAGCCTGAAACCCTGGG + Intronic
1117819152 14:59630498-59630520 GGCCTGCATCGTGCGGGCTTTGG + Intronic
1119325960 14:73759715-73759737 GCCCCGCCGCGTGCAGGCCTCGG + Intronic
1122268263 14:100556775-100556797 GGCCTGCAGGGTGAAGGCCTGGG + Intronic
1122659308 14:103283991-103284013 TGCCTGCTGCTTGCACGACTCGG - Intergenic
1122725476 14:103747981-103748003 GGCCGGCAGCGTGGAGGCCCAGG - Intronic
1122885535 14:104708802-104708824 GGCCTGCAGAGGGCACTGCTGGG - Intronic
1124414802 15:29466391-29466413 GGGCTGCAGCGTCCTCTCCTGGG - Intronic
1124414928 15:29466717-29466739 GGGCTGCAGCATCCACCCCTGGG - Intronic
1124414941 15:29466751-29466773 GGGCTGCAGCGTCCTCTCCTGGG - Intronic
1124414952 15:29466785-29466807 GGGCTGCAGCGTCCTCTCCTGGG - Intronic
1128509587 15:68305157-68305179 GGCCTCCAGCATGCATGCCATGG + Intronic
1129262175 15:74374534-74374556 GACCTGGAGCGTGAACGCGTGGG + Intergenic
1129692694 15:77722854-77722876 GGGCTGGAGAGTGCACCCCTGGG - Intronic
1132709615 16:1260509-1260531 AGCGTGCAGCGTGCCGGCCTGGG + Intergenic
1138106120 16:54287859-54287881 GGCCTGCAGTGGGCACGCCCCGG + Intergenic
1141169973 16:81684972-81684994 GGCCAGCAGAGTCCCCGCCTCGG - Intronic
1141819002 16:86432277-86432299 GGCCTGCCACGGGCCCGCCTCGG - Intergenic
1142007701 16:87697516-87697538 GGCGTGCAGGGTGGACGCGTGGG + Exonic
1144754399 17:17670447-17670469 GGCCTGCAGCATGCAGGCCAAGG + Intergenic
1144780864 17:17807745-17807767 GGCCTGCCCCTGGCACGCCTGGG - Intronic
1145831675 17:27921314-27921336 GGCCTGCAGTGGGAAGGCCTGGG - Intergenic
1148023070 17:44566364-44566386 TGCCTGCTGCGGGCACGCATGGG + Intergenic
1150067581 17:62124507-62124529 GGTCTGCAGCTTCCACACCTAGG + Intergenic
1151763813 17:76122043-76122065 GGCCTGCTGGGGGAACGCCTGGG - Intergenic
1151939116 17:77281664-77281686 GACCTGCAGTGTGCCCGCCGCGG - Intronic
1151967600 17:77439543-77439565 GGCCAGCAGCTTGCAGGACTTGG + Intronic
1152586238 17:81190674-81190696 GGCCTGCAGCGTGGCCAGCTCGG + Exonic
1153939818 18:9968209-9968231 GGCCTGCATGGAGCAAGCCTGGG - Intergenic
1154136624 18:11785520-11785542 GGCCTGCAGCCTCCAGGCCTGGG - Intronic
1160498029 18:79386550-79386572 GGCCTGAAGAGTGCCCTCCTGGG - Intergenic
1160703626 19:519221-519243 GGCCTGCAGCGCGCCCTCCAGGG - Exonic
1161319051 19:3632696-3632718 GGCCTGCAGAGGGGACGGCTGGG - Exonic
1161390112 19:4016297-4016319 GGCCCGCAGCGGGCACCCCGAGG + Intronic
1164243425 19:23409870-23409892 GGCCTGCAGGGTGGACACGTTGG - Intergenic
1165633086 19:37318026-37318048 GGCCTTCAGCGTCCGCGGCTGGG + Intronic
1166862888 19:45819937-45819959 GGCCTGCAGCGTGCACGCCTGGG + Intronic
1168293441 19:55368246-55368268 GGCCTGCAGGGTGCCCAGCTCGG + Exonic
1202697021 1_KI270712v1_random:132713-132735 GGCCTGGGCCGTGCACGCCGCGG + Intergenic
1202704647 1_KI270713v1_random:13895-13917 GGCCTGCAGCTTGCGCCACTAGG + Intergenic
925278515 2:2667285-2667307 GGCCTGCAGAATGCAGGTCTGGG - Intergenic
925283726 2:2702642-2702664 GGGCACCTGCGTGCACGCCTGGG - Intergenic
927720279 2:25377884-25377906 GGCCAGCAGAGCGCAGGCCTGGG + Intronic
930121357 2:47763646-47763668 GGTCTGCAGTCTGCATGCCTGGG + Intronic
934278182 2:91589727-91589749 GGCCTGGGCCGTGCACGCCGCGG + Intergenic
935310146 2:101775572-101775594 GGCCTGCTGTGTGCAGGCCCTGG + Intronic
942448191 2:176092446-176092468 TGGCTGCAGCGCGTACGCCTGGG + Intergenic
946272481 2:218605807-218605829 GTCCTGCAGTGGGCATGCCTTGG + Intergenic
1170546081 20:17436840-17436862 GGCCTGCAGCGTGAGCTCCCGGG - Exonic
1171176543 20:23054313-23054335 GGCCTTCAGCTTCCACACCTGGG - Intergenic
1171312205 20:24153619-24153641 CGCCATCAGGGTGCACGCCTGGG + Intergenic
1171534281 20:25872626-25872648 GGCCTTGAGAGTGCAAGCCTTGG + Intergenic
1171936380 20:31278573-31278595 GGCCTGGAGCTTGCACTGCTGGG + Intergenic
1173670089 20:44792959-44792981 TGCCAGCAGGGTGCACGGCTGGG - Intronic
1176062269 20:63177674-63177696 CGCCTGCAGCGTGGACCCCGTGG + Intergenic
1177525703 21:22287635-22287657 GGCTTGCAGCTTGCATGCTTTGG - Intergenic
1179503312 21:41823272-41823294 GGCCTGCCGTGAGCATGCCTGGG + Intronic
1180159606 21:45993165-45993187 GGCCTGCAGGGCGCCTGCCTGGG + Intronic
1181457519 22:23068172-23068194 GTCCTGCACCGTCCCCGCCTTGG + Intronic
1183959966 22:41405641-41405663 GGCCTGCTCCGTGCACCCCATGG - Intergenic
1184244519 22:43229050-43229072 GGTCTGCAGCCTGCCCGCCAGGG - Exonic
1184738987 22:46416285-46416307 GGCCTCCACCGTGCTGGCCTTGG - Intronic
953904616 3:46862213-46862235 GGCCTGCAGAATGCAAGCCTGGG + Intronic
960376035 3:116902718-116902740 TGTCTGCACCGTGCAGGCCTTGG + Intronic
961017850 3:123481281-123481303 GGCCTGGTTCCTGCACGCCTCGG - Intergenic
961404967 3:126672347-126672369 GGGCTGCTGGGTGCACCCCTGGG + Intergenic
964975487 3:162614676-162614698 GGCCTGAAGCATGGAAGCCTGGG - Intergenic
968744776 4:2353954-2353976 GACCAGCAGCGTGCACCGCTGGG + Exonic
969032567 4:4226609-4226631 GGCCTGGGCCGTGCACGCCGCGG - Exonic
969364473 4:6686141-6686163 AGCATGCACTGTGCACGCCTAGG + Intergenic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
983175153 4:164579543-164579565 GGTCTGCTGTGTGCACACCTTGG + Intergenic
984708063 4:182862351-182862373 GCCCTGCAGGGGGCCCGCCTGGG + Intergenic
989321093 5:40134653-40134675 GGCCTGCAGAGTGACAGCCTAGG + Intergenic
995527724 5:113064012-113064034 CGGCTGCAGCGTGCAGCCCTGGG - Exonic
996221325 5:120936699-120936721 CGCAGGCAGCGTGGACGCCTAGG - Intergenic
997778278 5:136630845-136630867 GGCCTGCAGGCTGCTCCCCTGGG + Intergenic
998340098 5:141409782-141409804 GGCCTGCAGCGTGAGCGCGAAGG - Exonic
999076110 5:148797205-148797227 GGCCTCCAGTGTCCAGGCCTGGG - Intergenic
1013246849 6:108294984-108295006 AGCCTTCAGCGTGCACGGCGGGG + Exonic
1018769209 6:166956936-166956958 GGCCTGCAGGGTGCGCGGGTCGG - Intronic
1019647598 7:2139359-2139381 GGCCCGCAGCGCTCCCGCCTTGG - Intronic
1024258604 7:47557946-47557968 GGCCTGCGGTGAGCAGGCCTCGG + Intronic
1030068449 7:105678461-105678483 GGCCTGCAGTGTGCATGCACTGG + Intronic
1035132664 7:156669843-156669865 GGCCTGCAGCACGCAGGGCTTGG + Intronic
1036507184 8:9366480-9366502 GGGCTGCAGCCAGCACACCTAGG + Intergenic
1039630559 8:39107586-39107608 GGCCCGCAGCGTGCGCCCCGAGG - Intronic
1040832936 8:51697471-51697493 GGCCTGCAGGGTTCAGGCATTGG - Intronic
1046934582 8:119874010-119874032 GGACTGCAGCGGGCACGCGTTGG - Intronic
1048875945 8:138837270-138837292 GGCCTCCAGAGTGCATGACTGGG + Intronic
1049471623 8:142777399-142777421 GGCCTGCAGTGAGCGCGGCTTGG - Intronic
1049807349 8:144547013-144547035 TGCGTGCTGCGTGCACGCCCTGG + Intronic
1056601758 9:88052390-88052412 GGCCTGCAGAGTGGACTCCTCGG + Intergenic
1057236438 9:93365611-93365633 GGCCTGCTGGGAGCATGCCTGGG + Intergenic
1057444242 9:95102903-95102925 GGCCTGCAACGAGCCCGCCAGGG + Intronic
1058931711 9:109726474-109726496 GCCATGCAGCCTCCACGCCTGGG + Intronic
1061828079 9:133274400-133274422 GGCCTGCAGCCTGCACCCCGTGG + Intronic
1061923834 9:133796507-133796529 GACCTTCAGTGTGCACTCCTGGG + Exonic
1062404624 9:136389543-136389565 GCCCTGCAGCTTGCACACCCCGG - Intronic
1194418094 X:93637924-93637946 GGCTTGCAGCTTGCACCCCCTGG - Intergenic
1196420168 X:115513093-115513115 GGCCTGTAGTGTCCACGCATAGG + Intergenic
1200053114 X:153445122-153445144 GGCCTGCAGCGTCCGCACCACGG + Exonic