ID: 1166863213

View in Genome Browser
Species Human (GRCh38)
Location 19:45821480-45821502
Sequence CCTCACCTGCAGCAGGCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166863207_1166863213 8 Left 1166863207 19:45821449-45821471 CCAGGGTTCAGCGGGGACAAGGC 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG 0: 1
1: 0
2: 5
3: 33
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166863213 Original CRISPR CCTCACCTGCAGCAGGCGGG AGG Exonic
900781969 1:4624296-4624318 CCTCCCCTGCAGCAGGGAGGAGG - Intergenic
900974391 1:6008078-6008100 CCTCACCTGCACCAATGGGGAGG + Intronic
900983352 1:6059038-6059060 CCTCTCCTGCAGCAGCCCTGTGG - Intronic
901907670 1:12428314-12428336 ACTCACCTCCAGCAGGCAAGGGG + Intronic
902217416 1:14943356-14943378 GCTCTCCAGCAGCTGGCGGGGGG - Intronic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
904004592 1:27357109-27357131 CTTCACCTGCAGGGGGAGGGAGG + Exonic
904408639 1:30311562-30311584 CCTCGCCTGCAGCATGCGGGGGG + Intergenic
904923807 1:34029943-34029965 CCTCACCTGTGCCAGGCAGGTGG + Intronic
905199537 1:36306739-36306761 CCTCACCTGCACCAGGCGCTCGG - Exonic
905253546 1:36665467-36665489 CCAGACCTGCAGCAGGCTGGAGG - Intergenic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
907853440 1:58278707-58278729 CCTGATCAGCAGCAGGCGGGGGG + Intronic
910449548 1:87331610-87331632 CCTCATTTGCTGGAGGCGGGCGG + Intronic
912337636 1:108877212-108877234 GCTCACCTCCCGCGGGCGGGCGG - Exonic
912467816 1:109886163-109886185 CCTCACCTGCTGGAGGTGAGGGG + Intergenic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
914716397 1:150258139-150258161 AATCACCTCCAGCAGGAGGGCGG - Exonic
915307793 1:154990590-154990612 GCTCACCTGCAGTAGTGGGGAGG + Intronic
915507931 1:156369115-156369137 CCTCACCTGCCGCAGGCCCAGGG - Intergenic
916026682 1:160839106-160839128 CAGCCCCTGCAGCAGGCAGGTGG - Intronic
916198848 1:162250627-162250649 CCTCAACTGCTGCATGGGGGTGG - Intronic
917345208 1:174022254-174022276 CCTCAGCAGCAGCAGGTGGGAGG - Exonic
917755558 1:178094285-178094307 GCCCACCTGCAGTCGGCGGGCGG - Exonic
919977400 1:202621662-202621684 CCTGACCTGCTCCAGGTGGGAGG + Intronic
922280151 1:224115122-224115144 CCTCTCCTAAAGCAGGTGGGTGG - Intronic
924442382 1:244096922-244096944 CCTGTCCTGCAGCAGACGTGAGG + Intergenic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1064347767 10:14548361-14548383 CCTCCCCTGGAGCTGGCAGGAGG - Intronic
1066524523 10:36262000-36262022 TCTCACATGCAGAAGGCAGGAGG - Intergenic
1067781517 10:49210928-49210950 CCTCACCTGCTCCAGGCCAGTGG - Intergenic
1069909053 10:71748823-71748845 CCTCCCCAGCAGCAGCAGGGAGG + Exonic
1070754304 10:78982116-78982138 CCTCACATGCTGCAGGGAGGTGG + Intergenic
1071617982 10:87094249-87094271 CCGCACCGGCAGGAGGCCGGAGG + Intronic
1075061280 10:119258746-119258768 CCCCACCTCCAGCAGGGGAGTGG + Intronic
1077065903 11:640839-640861 CCTCACCCTGAGCAGGCGGCCGG - Intergenic
1077177070 11:1195811-1195833 CCTGACGTGGAGCAGGCAGGTGG + Intronic
1079117809 11:17651800-17651822 AATCCCCTGCAGCAGGCAGGAGG + Intergenic
1080876149 11:36276137-36276159 CTTCATCTGGAGCAGGCAGGTGG + Exonic
1081549800 11:44100654-44100676 CATCTCCTGCAGCTGGAGGGTGG + Intronic
1084913707 11:72411828-72411850 CCTCAGCTGCAGCTGGGGAGGGG + Intronic
1085517609 11:77120696-77120718 CTCCACCTGCAGGAGGCGGGAGG - Exonic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086986234 11:93252098-93252120 CCTCACCAACAGGAGGCAGGAGG + Intergenic
1088893264 11:114060461-114060483 CCTCCCCTGCAAAAGGGGGGTGG - Intronic
1091656125 12:2348122-2348144 CCACTCCTGCAGCAGGCAGGAGG - Intronic
1091930644 12:4392638-4392660 CCTGACCTCCAGCAGGCTGAGGG - Intergenic
1092821440 12:12357135-12357157 CCGCACCTGCGGCCGGCGGGCGG - Exonic
1092880131 12:12881782-12881804 CCTGGCCTGCGGCAGGGGGGCGG - Intergenic
1095556615 12:43513897-43513919 CCTCACCCGCAACAGGCCTGGGG - Intronic
1100655134 12:96635982-96636004 CCTCCCCTCCAGGAGGTGGGAGG + Intronic
1100671653 12:96819839-96819861 CTTCAACTGCAACAGGAGGGTGG - Intronic
1101468385 12:104971454-104971476 CCACTCCTGCAGCTGGCCGGAGG - Intergenic
1101881429 12:108628677-108628699 CCGGACTTGCAGCAGGCCGGAGG + Intronic
1102450114 12:113035799-113035821 CCTCTACTGCGGCAGGAGGGAGG + Intergenic
1103282937 12:119775396-119775418 CCTGCCCTGCAGAAGGCTGGAGG - Intronic
1103317877 12:120071662-120071684 CTTCACCTGCAGCTGTCGGCAGG - Exonic
1104707310 12:130956643-130956665 CGGCTCCTGCAGCAGGCAGGTGG + Intronic
1105845534 13:24290758-24290780 CATCTGCTGCAGCAGGCGGCAGG - Exonic
1108086096 13:46795518-46795540 CTCCACCTGCAGCAGCCAGGGGG - Intronic
1113900452 13:113793931-113793953 CCACAGCAGCAGAAGGCGGGGGG - Intronic
1114482089 14:23042280-23042302 CCTCACCTGCCTCGGGCTGGCGG + Exonic
1119480276 14:74954399-74954421 CCAGCCCTGCAGCAGGCAGGCGG + Intronic
1120159376 14:81129454-81129476 CCAGGCCTGCAGCAGGTGGGTGG - Intronic
1121504273 14:94464451-94464473 GCTCTCCTGCAGCAGGCATGGGG + Intronic
1122486835 14:102087379-102087401 CCCCACCTGCCGCGGGCGGGCGG + Intronic
1122728540 14:103777555-103777577 CCTCTCCTGGAGCAGGCAGTGGG - Intronic
1124187396 15:27542328-27542350 CCACACCTGCAGCTGGGGAGTGG + Intergenic
1124493058 15:30170035-30170057 CCTGACCTGCTCCAGGTGGGAGG + Intergenic
1124750476 15:32368290-32368312 CCTGACCTGCTCCAGGTGGGAGG - Intergenic
1126694241 15:51312849-51312871 CCTCACAAGCAGCTGGAGGGAGG - Intronic
1127306833 15:57714331-57714353 CTTCAACTGTAGCAGGCTGGTGG + Intronic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1128633958 15:69291125-69291147 CCTCCTCTGCAGCAGGCTGGAGG - Intergenic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1129688943 15:77702297-77702319 GGACACCTGCATCAGGCGGGTGG + Intronic
1131270187 15:90942519-90942541 CATAACCTGCAGCAGGTGGCAGG - Exonic
1131430834 15:92387668-92387690 CATCCCTTGCAGCTGGCGGGGGG + Intergenic
1132349931 15:101133298-101133320 CCTCACCTGCACCATGCGCCAGG + Intergenic
1132709868 16:1261672-1261694 ACTCGCCTGCTGCAGGCGGTAGG + Intergenic
1132865873 16:2092490-2092512 CCGCACCTGCCGCAGCCGTGGGG + Exonic
1132907126 16:2288387-2288409 CAGCACCTGCCGCAGGTGGGTGG - Intronic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1133406329 16:5527386-5527408 CCTCACCTGCATTAAGCCGGTGG - Intergenic
1133932298 16:10242374-10242396 CATGACCTGCAGCAGGCGGCTGG + Intergenic
1138594276 16:58021404-58021426 CTGCAGCTGCAGCAGGCAGGAGG - Exonic
1139650943 16:68361764-68361786 CCACACATGCAGGAGGCAGGTGG + Intronic
1140756781 16:78074741-78074763 CCTCACCTGAAGCAGGAGAAGGG + Intergenic
1141644620 16:85360562-85360584 CCTCTCATCCGGCAGGCGGGCGG + Intergenic
1141963461 16:87425056-87425078 CCTCAGTTTCAGCAGGCAGGAGG - Intronic
1142593706 17:1019439-1019461 CCACACCTGCAGCAGGCACCAGG - Intronic
1142593717 17:1019487-1019509 CCACACCTGCAGCAGGCACCAGG - Intronic
1142617583 17:1145476-1145498 CCAGAGCTGCAGAAGGCGGGTGG + Intronic
1142855085 17:2724635-2724657 CCTCGTGGGCAGCAGGCGGGCGG + Intergenic
1143354308 17:6314075-6314097 TCTCCCCTGCAGCAGGTGGGTGG - Intergenic
1144215056 17:13048097-13048119 CCTGACCTCCAGCAGGCTGATGG - Intergenic
1144366043 17:14545799-14545821 CCTCACCTACTGCAGATGGGAGG + Intergenic
1145009230 17:19358014-19358036 CCTTACCTTCAGCAGGCAGTTGG + Intronic
1145065664 17:19759788-19759810 CTTCTCCTCCAGCAGGCAGGAGG - Intergenic
1146277304 17:31523876-31523898 GCTTACCTGCAGCAGGGGGCCGG - Exonic
1147629920 17:41923520-41923542 ACTCACCTGCAGCAGGTTGCAGG - Intronic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1149270260 17:54969207-54969229 CCACAGCTGGAGCAGGAGGGAGG + Intronic
1151569586 17:74919600-74919622 CTTCTCCTGCCGCAGGAGGGCGG + Exonic
1151719540 17:75847481-75847503 CCTCACCTGCAGGAGTGGAGGGG + Exonic
1152185886 17:78856078-78856100 GCACACCTGCAGTAGGAGGGGGG - Intronic
1152380240 17:79938572-79938594 ATTCCCCTGGAGCAGGCGGGTGG + Exonic
1152761070 17:82107293-82107315 ACACACCTGCAGCAGGTTGGGGG + Intronic
1156459679 18:37314713-37314735 CCTCCCCTGCAGCTTGTGGGGGG + Intronic
1156509643 18:37625765-37625787 CCTCACCTGATGCAGGCTGGGGG - Intergenic
1158976673 18:62716375-62716397 GCCCAGCTGCAGCAGGCGGGCGG - Exonic
1159037616 18:63292910-63292932 CATCACCTGCAGCAGCAGGAAGG - Intronic
1159061085 18:63514517-63514539 TCTCAGCTGCAGCAGGAGAGGGG - Intergenic
1160488483 18:79316332-79316354 CCTCACATTCAGGCGGCGGGTGG - Intronic
1160669407 19:352187-352209 CCTCACCACCAGCATGCTGGTGG + Intergenic
1160694890 19:478762-478784 CCTCGCCTGCAGCCGGCAGCTGG - Intergenic
1161315241 19:3614584-3614606 GCTCACCTGCAGCGGGGTGGGGG + Exonic
1162918203 19:13885431-13885453 CCTCACACACAGCAGGCTGGAGG + Intronic
1162971415 19:14183387-14183409 CCTCAGCTGGAGCAGGCCAGTGG - Intronic
1163032611 19:14554201-14554223 TCTCTCCTGCAGCAGCCGGAGGG - Intronic
1163250348 19:16123000-16123022 CCTCCCCTGCACCAGGCAGTGGG + Intronic
1163436930 19:17301476-17301498 CTTCACCCGCAGCACGCGGCCGG + Exonic
1163508531 19:17721963-17721985 CCTCTCCAGCAGCAGCCGGGAGG - Intronic
1163821985 19:19501185-19501207 CTTCACGTGCCGCTGGCGGGAGG + Exonic
1166071946 19:40393086-40393108 CCTCACCGGCAGAGGGCAGGTGG + Intergenic
1166275173 19:41748533-41748555 CTGCACCTGCAGCAGCCAGGTGG + Intronic
1166280191 19:41787329-41787351 CTGCACCTGCAGCAGCCAGGTGG + Intergenic
1166412516 19:42565612-42565634 CTGCACCTGCAGCAGCCAGGTGG - Intergenic
1166528364 19:43527091-43527113 CCGCACCTGCCGCAGGAGGATGG + Exonic
1166767860 19:45263150-45263172 CCTCACCTTCTGCAGGCTGCTGG - Exonic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1167419719 19:49395697-49395719 CCTCACCAGCCACAGGCAGGGGG - Intronic
1167709329 19:51100222-51100244 CCCCATATGCAGTAGGCGGGTGG - Intronic
1168691373 19:58379587-58379609 GCTCACCTGGGGCAGGTGGGAGG - Intronic
925098668 2:1227953-1227975 CATCCCCTGCACGAGGCGGGAGG - Intronic
926312085 2:11682174-11682196 GCTCACCTGCAGGAGGAGTGGGG - Intronic
926707480 2:15846959-15846981 CCTCACCTGCTGCAGGGTGGAGG + Intergenic
927713565 2:25340141-25340163 TCTGGCCTGCGGCAGGCGGGAGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
937317853 2:120943427-120943449 CCTCAGTGGCAGCAGGCGAGGGG - Intronic
939068778 2:137515465-137515487 CCTCACCTGTAGGAGCCTGGTGG - Intronic
940330228 2:152466236-152466258 CCTCCCCCGCAGCGGGCAGGAGG - Intronic
941934950 2:170974886-170974908 CCACAACTACAGCAGGCAGGTGG - Intergenic
947815330 2:233032856-233032878 CCTCACCTGAACCTGGTGGGTGG - Exonic
947980579 2:234405318-234405340 CCTCACCTGCAGCTGGCTGGAGG - Intergenic
948632198 2:239309562-239309584 CTTCTCCTGCACCTGGCGGGAGG + Intronic
1170107038 20:12762960-12762982 CATCTGCTGCAGCAGGCTGGAGG + Intergenic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1172273016 20:33664926-33664948 CCTTGCCTGCACCAGGCTGGAGG + Intronic
1172321266 20:33996961-33996983 CCTCACCTGCAGCAGAGATGTGG + Intronic
1172513414 20:35515899-35515921 CCTCACCTCCAGCAGGGTAGAGG - Exonic
1174056070 20:47799400-47799422 CCACACCTGTGGCAGGTGGGAGG - Intergenic
1174274042 20:49390649-49390671 CCTCCCCTGCAGCTGGATGGAGG + Intronic
1175801616 20:61804289-61804311 CCTCACCTGCACCATGTGGCTGG - Intronic
1175811957 20:61863273-61863295 CCTCACCTGCAGCCGGGGCGGGG + Intronic
1175900794 20:62359192-62359214 CCTCATCTGAGGGAGGCGGGAGG + Intronic
1175990350 20:62785493-62785515 CCACAGCTGGAGCAGGCGAGGGG + Intergenic
1176185914 20:63778973-63778995 CCTGACCTGCAGATGGCGGCAGG + Intronic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179786729 21:43734533-43734555 CCTCAGCTCCAGGAGGCAGGTGG - Intronic
1180145348 21:45915628-45915650 CTTCACCTGCTGCAGTAGGGAGG - Intronic
1180258007 21:46646935-46646957 CCTCACGTGGTGAAGGCGGGAGG + Intronic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1181868313 22:25876973-25876995 GCCCACCCACAGCAGGCGGGTGG - Intronic
1183386162 22:37515968-37515990 CGTGACCTGCAGCTGGCGGTAGG - Exonic
1184334402 22:43844862-43844884 CCACACCTGGTGCAGGCAGGAGG + Intronic
1185191219 22:49437812-49437834 CCGCACCTGCTGCAGGTGTGGGG - Intronic
1185206351 22:49541347-49541369 CCTCACCTGCAGCTCCCGCGCGG + Intronic
949894611 3:8759969-8759991 TCTCACCTGGAGGAGGCGGGAGG - Intronic
950211148 3:11124482-11124504 CCTCAAATGGAGCAGGCAGGTGG + Intergenic
952211677 3:31234268-31234290 CTTCACACGCAGCAGGCGGCAGG + Intergenic
954003893 3:47577920-47577942 CCTCACGCGCTGCGGGCGGGAGG + Exonic
954633550 3:52059446-52059468 CCTCACCTGCAGCTCCCAGGAGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956487803 3:69740225-69740247 CCTCACCTGCAGGAGCCCAGAGG - Intronic
957465601 3:80586310-80586332 CCTCACCTGCAGCACAAGAGGGG - Intergenic
961569052 3:127785202-127785224 CTCCACCTGCAGCAGGTGTGTGG - Intronic
962722319 3:138187521-138187543 CGGCGCCTGCAGCAGCCGGGTGG + Exonic
969304355 4:6317343-6317365 CCAGCCCTGCAGAAGGCGGGAGG - Intergenic
969337027 4:6517081-6517103 CTTCACCAGCCCCAGGCGGGAGG + Intronic
969571338 4:8010424-8010446 TCTTACCTGCAGCGGGCGGCGGG + Intronic
969583666 4:8079972-8079994 CCTCACCTGCACCATGCGGAAGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
972644741 4:40956437-40956459 CCTCCCCTCCAGCAGGCCAGTGG - Intronic
974024513 4:56721638-56721660 GATCACCTGCAGCAGGAGTGAGG + Intergenic
978013980 4:103721153-103721175 CCTCAACAACAGCAGGCCGGAGG + Intergenic
984069277 4:175092195-175092217 CCGCACCTGGAGCAGCCGGCTGG + Intergenic
984795867 4:183659413-183659435 CCTCAGCTGCAGCGGGCCCGGGG + Exonic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
986300602 5:6475803-6475825 CCTCTCCAGCTGCAGGCTGGAGG - Intronic
987113683 5:14710639-14710661 CCACACATGCAGGAGGCGGGTGG - Exonic
987196898 5:15536018-15536040 CCTGAGCTGGAGCAGGTGGGAGG - Intronic
989678217 5:43997780-43997802 CCCTGCCTGCAGCAGGCGGGAGG - Intergenic
991975393 5:72179545-72179567 GCTTTCCTGCGGCAGGCGGGCGG - Intronic
996220030 5:120919889-120919911 CCTCTCCTGCAGCAGGCACATGG - Intergenic
996329393 5:122312177-122312199 CCTCAGCCGAAGTAGGCGGGCGG - Exonic
999729826 5:154468332-154468354 CCTGGCCTGGAGCAGGCCGGTGG - Intergenic
1000198531 5:158985022-158985044 CCTCACCTGCCGTAGATGGGAGG - Intronic
1002376793 5:178794788-178794810 CCTAGGCTGCGGCAGGCGGGAGG - Intergenic
1003175283 6:3749551-3749573 CCTCACCTGGAGCAGGAGGGAGG - Intronic
1004509884 6:16277000-16277022 CCTCAGCTGCAGTAGGCCTGGGG - Intronic
1006082271 6:31574488-31574510 CTTCCCCTGCAGCAGTCTGGCGG - Intergenic
1006131857 6:31874454-31874476 TCTCACCTGGAGCAGAGGGGAGG + Exonic
1007217833 6:40254293-40254315 CCTGAACTGCAGCAGGAGAGAGG - Intergenic
1007422698 6:41729105-41729127 CCTCCCCTGCAGCAGGGCTGTGG + Intronic
1010029389 6:71257361-71257383 CCGCATCTGCAGCAGGCAGAAGG + Intergenic
1012500180 6:99879694-99879716 CCTCACCAGCAGCAGCCTGTTGG - Intergenic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019256200 7:53726-53748 CCCCAAGTGCAGCAGGCGGGAGG + Intergenic
1019473239 7:1232274-1232296 CCTCTCCGGCTGCAGGCGGCGGG - Intergenic
1019720816 7:2569489-2569511 CCTCACCCTCAGCAGGAGGAGGG + Intronic
1019768334 7:2867370-2867392 CCTCCCCTGCAGCCTGGGGGTGG + Intergenic
1020130451 7:5556225-5556247 CCTGGCCTGCAGCAGGCAGAGGG - Intronic
1021986808 7:26105261-26105283 CCTGCCCTGCAGAAGGCTGGAGG - Intergenic
1024186084 7:46949414-46949436 CCTCACCTCCAGCAGAGGGAGGG + Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1025236925 7:57240754-57240776 CCACACCTGCGGCAGGTGGGCGG + Intergenic
1033137595 7:138798028-138798050 ACTCACCTGCAGCAGGCACTCGG + Exonic
1035018599 7:155787517-155787539 CCTGGCCTGCAGCGGGCGGGCGG - Intergenic
1036709066 8:11066809-11066831 CCCCACCTGCAACAGGCTGGGGG + Intronic
1038335414 8:26641751-26641773 CCCCACCCCCAGCAGGAGGGAGG - Intronic
1045300623 8:100907524-100907546 CCTCACATGCAGCAGGTGCCTGG - Intergenic
1045490709 8:102666853-102666875 CCTCACCTCCAGTAGGCAGCTGG + Intergenic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049421355 8:142517980-142518002 CCTCGTCTGCAGGGGGCGGGTGG + Intronic
1049550379 8:143255104-143255126 CCTCTCTAGCAGCAGGCAGGTGG + Intronic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1055082507 9:72281135-72281157 CCTCAGCTGCAGCAGCCTGCGGG - Intergenic
1057150469 9:92791891-92791913 CCGCACATGCAGCTGGCAGGTGG + Intergenic
1057506122 9:95634896-95634918 CCTCGCCTGCAGCAGTAGTGTGG + Intergenic
1057818630 9:98314596-98314618 CCTCACCGGGAGCAGGAGGGAGG - Intronic
1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG + Intergenic
1060877506 9:127093826-127093848 CCACACCTGCATGAGGCGGTTGG + Exonic
1060929335 9:127479109-127479131 CCTCACATGCCTCAGGTGGGTGG + Intronic
1060998336 9:127887478-127887500 GCTCACCTGCAGTAGTTGGGGGG + Exonic
1061625714 9:131839496-131839518 CCTCACCAGCTGCAAGCAGGAGG + Intergenic
1062284016 9:135765179-135765201 CCTCACCTGGAGCCGGGGGTGGG - Exonic
1062448468 9:136605515-136605537 TCTCACATGGAGCAGACGGGCGG - Intergenic
1062491912 9:136808721-136808743 ACTCACCTGCAGGAGGTGCGGGG + Intronic
1185463851 X:344115-344137 CCTCACCAACGGGAGGCGGGAGG + Intronic
1185463901 X:344304-344326 CCTCACCAACGGGAGGCGGGAGG + Intronic
1188027493 X:25226043-25226065 CCTCACCTGCAGCAACTGTGTGG + Intergenic
1188577096 X:31664611-31664633 CCTCAACTGGAGCAGGAGGCAGG + Intronic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1189324126 X:40102770-40102792 CCTCGCCTGCAGCAGGAAGGTGG + Intronic
1196022764 X:111007511-111007533 CCTCACCTGGAGGAGGCAGCTGG - Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1199744684 X:150764630-150764652 CCTCACCTGGCGGAGGCTGGGGG + Exonic
1200073985 X:153542260-153542282 CCTCCCCTGGGGCAGCCGGGAGG + Intronic
1201305041 Y:12542642-12542664 CCTCATCTGCAGGTTGCGGGTGG + Intergenic