ID: 1166863762

View in Genome Browser
Species Human (GRCh38)
Location 19:45824054-45824076
Sequence CCATGTCTGGAGGAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 293}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166863762_1166863777 20 Left 1166863762 19:45824054-45824076 CCCTGCAGCTCCTCCAGACATGG 0: 1
1: 0
2: 4
3: 26
4: 293
Right 1166863777 19:45824097-45824119 CTGGCTGGGCTGTCCTCCTGCGG 0: 1
1: 0
2: 2
3: 41
4: 332
1166863762_1166863769 1 Left 1166863762 19:45824054-45824076 CCCTGCAGCTCCTCCAGACATGG 0: 1
1: 0
2: 4
3: 26
4: 293
Right 1166863769 19:45824078-45824100 CCTGCTCCAGCTCCCAGCCCTGG 0: 1
1: 1
2: 14
3: 134
4: 866
1166863762_1166863771 6 Left 1166863762 19:45824054-45824076 CCCTGCAGCTCCTCCAGACATGG 0: 1
1: 0
2: 4
3: 26
4: 293
Right 1166863771 19:45824083-45824105 TCCAGCTCCCAGCCCTGGCTGGG 0: 1
1: 1
2: 8
3: 53
4: 479
1166863762_1166863770 5 Left 1166863762 19:45824054-45824076 CCCTGCAGCTCCTCCAGACATGG 0: 1
1: 0
2: 4
3: 26
4: 293
Right 1166863770 19:45824082-45824104 CTCCAGCTCCCAGCCCTGGCTGG 0: 1
1: 2
2: 12
3: 71
4: 556
1166863762_1166863778 21 Left 1166863762 19:45824054-45824076 CCCTGCAGCTCCTCCAGACATGG 0: 1
1: 0
2: 4
3: 26
4: 293
Right 1166863778 19:45824098-45824120 TGGCTGGGCTGTCCTCCTGCGGG 0: 1
1: 1
2: 3
3: 44
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166863762 Original CRISPR CCATGTCTGGAGGAGCTGCA GGG (reversed) Intronic
900181613 1:1313530-1313552 CCATTTCCGGAAGATCTGCAGGG + Exonic
900571258 1:3359559-3359581 CCGAGCCTGGAGTAGCTGCAGGG - Intronic
900688425 1:3964493-3964515 TCTTGTCTGCAGCAGCTGCACGG - Intergenic
901234909 1:7662594-7662616 CCGGGGCTGGAGGAGCTGCCAGG + Intronic
901701205 1:11045534-11045556 CAATGTCTGGGGGAGAGGCAGGG + Exonic
903444792 1:23415544-23415566 CCATGTCTGGAGCACCTGTGTGG - Intronic
903970371 1:27114931-27114953 CCGTGTCTTGAGCAGCTGCCTGG - Intronic
904453915 1:30635611-30635633 ACATGTGTGGTGGAGCTGGACGG - Intergenic
905371930 1:37486975-37486997 ACATATCTCTAGGAGCTGCAGGG + Intergenic
905528836 1:38660553-38660575 ATCTGTCTGGAGCAGCTGCAGGG + Intergenic
905803027 1:40857807-40857829 TCATCCCTGGAGGAGCTGCCAGG - Intergenic
905972269 1:42151093-42151115 CCCTGGCTGGAGGAGCCACAGGG + Intergenic
907379171 1:54071464-54071486 CCATGTCATGAGCAGCTCCAAGG - Intronic
909068449 1:70963617-70963639 CCATGGCTGGAGCAGCTGCAGGG + Intronic
909371178 1:74885100-74885122 CCATGGCTGGAGCAGCTGGGAGG - Intergenic
910713348 1:90204278-90204300 CCCTTCCTGGAGGTGCTGCAGGG + Intergenic
911011776 1:93288412-93288434 CCATGGCTGGAGCAGCTGGGAGG - Intergenic
911498383 1:98657927-98657949 CCATTTCATGAGGAGCTGCTTGG - Intergenic
915563927 1:156703563-156703585 CCAGGTCTGGAGGAGGTCCAGGG - Intronic
917843665 1:179002873-179002895 TCATGTTTGGAGGTGCAGCACGG + Intergenic
917979280 1:180259424-180259446 CTGTGTCTGGTGGAGGTGCATGG + Intronic
918414754 1:184295219-184295241 CCATGTCTGGATAAGGTCCATGG + Intergenic
920314395 1:205067093-205067115 CGATGTTTGCAGGATCTGCAAGG - Exonic
920665337 1:207959269-207959291 TCATGTTTGGAGGAGCGGCGCGG - Intergenic
921012977 1:211161374-211161396 CCAGGTGTGGAGGACCTGCCTGG + Intergenic
922536063 1:226381818-226381840 CCAGAACTGGAGTAGCTGCAAGG + Intronic
922960445 1:229641599-229641621 CCATGGCTGGGGCACCTGCACGG - Intronic
923129326 1:231061542-231061564 CATTGTCTGGAGGTGGTGCAGGG - Intergenic
923253042 1:232194668-232194690 GCATGGCTGGAGGAGCTCTAGGG + Intergenic
923641532 1:235766181-235766203 CCAAATCTGGAGGAGATCCAAGG + Exonic
923934721 1:238747883-238747905 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
924850759 1:247828053-247828075 GCATATCTGGAAGAGCTGTAGGG - Intergenic
1063024426 10:2164042-2164064 TCATGGCAGGAGGAGATGCAGGG - Intergenic
1064898214 10:20262849-20262871 CCAGGCCTGGAGGACCTGCCTGG - Intronic
1067084328 10:43229938-43229960 CGCTGTCAGGAGGAGCTGCCTGG + Intronic
1068008863 10:51422498-51422520 CCCTGTGTGGAGGAGCTGCCTGG - Intronic
1069662971 10:70135919-70135941 CCAGGGCTGGAGGAGCTCCAAGG + Intergenic
1071751995 10:88489727-88489749 CCATGTCTGTTGGATCTGTAAGG + Intronic
1073420694 10:103421519-103421541 CAGTGCCTGGAGGAGCTGCAGGG + Exonic
1074597089 10:114877348-114877370 GGATTTCTGAAGGAGCTGCATGG - Intronic
1075399721 10:122152069-122152091 CCATGTTTGGTGGAGCCACATGG - Intronic
1075666310 10:124233491-124233513 GCATGTCTGGAGGGGAAGCAGGG - Intergenic
1076452887 10:130568995-130569017 CCATCTCTGGAGGAGCAGGTTGG + Intergenic
1076764270 10:132624653-132624675 GCATGTATGGAGGTGCTGAACGG - Intronic
1078107236 11:8366016-8366038 GTAAGTCTGAAGGAGCTGCAGGG + Intergenic
1078355490 11:10628996-10629018 CCATCTCTTGAGCAGCAGCAGGG - Intronic
1079938734 11:26651132-26651154 CAATATTTGGAAGAGCTGCATGG + Intronic
1080590871 11:33722281-33722303 CCAGGCCTGGAGGAGCAGCTGGG + Intronic
1082177755 11:49081311-49081333 GCATGTCTGGAGGAGCTCTTGGG + Intergenic
1082182402 11:49135386-49135408 GCATGTCTGGAGGAGCTCCTCGG - Intergenic
1083633787 11:64109374-64109396 CCAGGTCTGGGGGAGCAGTAGGG - Intronic
1083903418 11:65654836-65654858 CCATGGCTGGAGCAGGGGCAGGG + Exonic
1084289852 11:68155622-68155644 CTGTGTCTGGAGGTGCTGGAGGG - Exonic
1085304153 11:75475796-75475818 CCAAGGCTGGAGGGGCAGCAGGG - Intronic
1085327050 11:75614236-75614258 CCCTGGCTGGAGCAGCCGCAGGG - Intronic
1085466027 11:76723912-76723934 CCTTGGCTGCAGGGGCTGCAGGG - Intergenic
1086002899 11:82002064-82002086 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
1086569153 11:88263016-88263038 CCAGGCCTGGAGGACCTGCCTGG + Intergenic
1086687966 11:89754549-89754571 GCATGTCTGGAGGAGCTCTTGGG - Intergenic
1086717883 11:90085345-90085367 GCATGTCTGGAGGAGCTCTTGGG + Intergenic
1088837638 11:113591319-113591341 CCATGTCTGGAGTGGCTGGTGGG - Intergenic
1089009151 11:115118794-115118816 CCAGGTCTTGAGGAACAGCAGGG - Intergenic
1090380220 11:126321292-126321314 CCAGGTCTGGAAGAGATTCAAGG + Intronic
1090514808 11:127413024-127413046 CCATGGCTTGGGAAGCTGCACGG + Intergenic
1091805067 12:3350093-3350115 CAGTGTCTGGAGGACGTGCAGGG - Intergenic
1093369937 12:18354452-18354474 CCATCTCAGGAGAGGCTGCAAGG - Intronic
1093432074 12:19095476-19095498 CCATTTGTGGAGGAGTTGCAGGG + Intergenic
1094851539 12:34384471-34384493 CCATGTGTGTAGGTGCTCCATGG + Intergenic
1096537524 12:52284880-52284902 CCATGCATGAAGGAGCTGAATGG + Intronic
1097077930 12:56408913-56408935 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
1097747443 12:63316372-63316394 CCATCTCAGGAGAGGCTGCACGG - Intergenic
1098105153 12:67062013-67062035 CCATCTCCTGAGTAGCTGCACGG + Intergenic
1100215226 12:92440965-92440987 CCCTGTATGGAGGAGATGTATGG - Intergenic
1101344276 12:103871352-103871374 CCGAGTCAGGAGGAGCTGCTTGG + Intergenic
1101994901 12:109518295-109518317 GCAGGTCTGGAGGAGCTGAGTGG - Intronic
1103713365 12:122929232-122929254 CCAGGTCTGGAGGGGCCTCAGGG - Exonic
1104037747 12:125109743-125109765 GCATGTCTGGAGCAGCTCCTTGG + Intronic
1104874895 12:132026930-132026952 TCATGTCAGGAGCAGCTCCAGGG + Intronic
1105424655 13:20284120-20284142 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1107225769 13:38045596-38045618 CCATGCCTGGAGGCCCTGCCTGG - Intergenic
1107561444 13:41560676-41560698 CCCTGTCTGAAGGAGCTGTGAGG + Intergenic
1111670204 13:91320496-91320518 CCATCATTGGAGGATCTGCAGGG - Intergenic
1113165813 13:107440828-107440850 CCATCTCTGAAGGAGCTCCTTGG - Intronic
1113222490 13:108120829-108120851 CCATGAGTGGAGGAACAGCAGGG - Intergenic
1113475753 13:110579865-110579887 CAATGCCTGAAGGAGCTGAAAGG - Intergenic
1113736156 13:112680265-112680287 CCAAGTGTGGAGGAACAGCAGGG + Intronic
1113744301 13:112732141-112732163 CCCTGAATGGAGGAGCTGCTTGG - Intronic
1114228168 14:20757511-20757533 CCATGGCGGCAGGAGCTGCTGGG - Intergenic
1117496705 14:56312715-56312737 CCATTTCTGCAGGAGATGCTAGG - Intergenic
1119568150 14:75646327-75646349 CCCTGGCTGGAGCAGCTGCCTGG - Intronic
1122642127 14:103166115-103166137 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1122710266 14:103651664-103651686 CCAAGGCTAGAGGAGCAGCACGG - Intronic
1122740067 14:103867152-103867174 CTATGCCTGGAGGAGCAGCGAGG + Intergenic
1123134112 14:106011779-106011801 CCGGGTCTGGAGCAGGTGCAGGG - Intergenic
1123473656 15:20572064-20572086 GCATGGCAGGGGGAGCTGCAGGG + Intergenic
1123733956 15:23167075-23167097 GCATGGCAGGGGGAGCTGCAGGG + Intergenic
1124284459 15:28388386-28388408 GCATGGCAGGGGGAGCTGCAGGG + Intronic
1124298238 15:28523228-28523250 GCATGGCAGGGGGAGCTGCAGGG - Intronic
1124606643 15:31174389-31174411 CCATGTCTGGGAGTGCTGCAAGG + Intergenic
1124606835 15:31175713-31175735 CCAGGCCTGGAGGAGCTGGTGGG + Intergenic
1125083965 15:35708217-35708239 AGATGTCTGGAGGAGAAGCAAGG + Intergenic
1125536603 15:40444232-40444254 GCATTTCTGGAGAAGCTGAAAGG - Intronic
1126310633 15:47312513-47312535 ACATGTCTGGAGGTTCTTCAGGG - Intronic
1127691684 15:61403124-61403146 CTACCTCTGGAGGAGATGCAAGG - Intergenic
1128727290 15:69997643-69997665 CCATGTCTTGGGTGGCTGCAAGG + Intergenic
1128904354 15:71453850-71453872 CCATGCCTGGAAGAGATGCCTGG - Intronic
1129159172 15:73737694-73737716 GCCGGTCTGGAGCAGCTGCAGGG - Exonic
1129524770 15:76206723-76206745 CCATGCCAGGGGGAGCTGCAAGG + Intronic
1130907169 15:88249017-88249039 CCATGCCTGGAGGAGCTGCTGGG + Intronic
1132379338 15:101355738-101355760 CCAGGTCATGAGGAGGTGCAGGG + Intronic
1132616379 16:842924-842946 CCCTGTCTGGTGGAGGTGGATGG - Intergenic
1133446508 16:5865605-5865627 CCAGGTCAGTGGGAGCTGCAGGG + Intergenic
1133901083 16:9975446-9975468 CCATTGCTGGAGGAGCTACATGG + Intronic
1134383295 16:13748025-13748047 CCTGGTCTGGGGGAGCTGAATGG - Intergenic
1135770851 16:25217294-25217316 CCATGTCTGGTCGAACTGCTGGG + Exonic
1136276798 16:29183590-29183612 CCATGTCTCCAGGAGCTGCTGGG - Intergenic
1137251805 16:46746826-46746848 GCAGCTCTGAAGGAGCTGCAGGG + Intronic
1137251931 16:46747369-46747391 CCATGTGTGAAGGAGCAGAAGGG + Intronic
1137534878 16:49312589-49312611 TCATGAATGGAAGAGCTGCAGGG - Intergenic
1137850316 16:51735493-51735515 CAATGCCTGGAGGATATGCATGG - Intergenic
1138232596 16:55349823-55349845 CAATTTCTGGAAGAGCTGCTTGG + Intergenic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1141281734 16:82635312-82635334 CCAAATCTGGAGGAGCAGTAGGG + Intronic
1142081177 16:88149650-88149672 CCATGTCTCCAGGAGCTGCTGGG - Intergenic
1142115739 16:88355231-88355253 CCATGGCTGGAGGTGCTTAAAGG + Intergenic
1142642512 17:1292602-1292624 CCATGTGCGAAGGTGCTGCATGG - Intronic
1143603024 17:7961645-7961667 CCCTCTCTGGAGGAGTTTCACGG + Intergenic
1144367791 17:14561270-14561292 CCATGCCTCAAGGAGCAGCAAGG + Intergenic
1144714826 17:17426688-17426710 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1146658849 17:34651422-34651444 CCAGGCCTGGAGGAGCAGAACGG + Intergenic
1146824389 17:36010332-36010354 CCATCTCGGGAGAGGCTGCAAGG + Intergenic
1147864152 17:43542036-43542058 CCATGTGTGGAGGGCATGCATGG - Intronic
1148138203 17:45309371-45309393 CCATGACTATAGGAGCTGGAGGG - Intronic
1148189560 17:45669073-45669095 CATTGCCTGGAGGGGCTGCAGGG - Intergenic
1148661615 17:49338344-49338366 CCTTGTCTGGATGTGATGCATGG + Intronic
1148716778 17:49721648-49721670 GCATGTCAGGAGGAGCTGATGGG + Intronic
1150273353 17:63880892-63880914 CCATGACTGGATGAGCAGCAGGG + Exonic
1150278955 17:63917880-63917902 CCACGACTGGATGAGCAGCAGGG + Exonic
1151545637 17:74791272-74791294 CCCTGGCTGGAGTAGCTGCCTGG - Intronic
1151682628 17:75629874-75629896 GCATGTCAGGAGGAGCTGGCGGG - Intronic
1153098399 18:1436114-1436136 CCATGCCTGGAGAAGCGCCAGGG - Intergenic
1153878939 18:9403924-9403946 CCAGGTCTGGAGCAGCCCCATGG - Intergenic
1153968390 18:10202708-10202730 ACCTGTCTGGAAGAGCTGCAGGG + Intergenic
1155151854 18:23129305-23129327 CCATGATTGGCTGAGCTGCATGG + Intergenic
1155412116 18:25557960-25557982 ACATGTCTACAGGAGCTGCCAGG - Intergenic
1155786937 18:29913703-29913725 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1157028527 18:43876496-43876518 CCAACTCTGGAGAAGCTGCCAGG + Intergenic
1157238783 18:45989718-45989740 GCTTGTTTGGAGTAGCTGCAGGG + Intronic
1157709888 18:49842977-49842999 GCATGTCTGGAGGCTCAGCAGGG + Intronic
1157818443 18:50748274-50748296 CTGTGACTGCAGGAGCTGCAGGG + Intergenic
1160071916 18:75636346-75636368 CAATGTCTGGAAGGGCTCCAAGG + Intergenic
1160679385 19:405808-405830 CCAGGACTGGAGGAGCAGCTGGG - Exonic
1161369930 19:3905426-3905448 GCGTGTTGGGAGGAGCTGCAGGG - Exonic
1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG + Intergenic
1164567422 19:29337269-29337291 CCATATCTGGAGTAGAGGCAGGG - Intergenic
1164602735 19:29574182-29574204 CCATGGCAGGTGGAGGTGCAGGG - Intergenic
1165429561 19:35764846-35764868 CCATGTGTGGAGGTTCTGCAGGG - Exonic
1166040345 19:40198544-40198566 TGATGTCTGGAGGTGCTGAAAGG + Exonic
1166235017 19:41449550-41449572 CCTTGGCTGGAGGGGCTGCAGGG - Intergenic
1166863762 19:45824054-45824076 CCATGTCTGGAGGAGCTGCAGGG - Intronic
1168676871 19:58284963-58284985 CCCTGTCTGAAGGAGCAGCAGGG - Intronic
925930105 2:8700123-8700145 ATATGCCTGGAGGAGTTGCATGG - Intergenic
925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG + Intergenic
926405615 2:12549435-12549457 CCATGTCTGGAGCCTTTGCAGGG - Intergenic
927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG + Intergenic
927905093 2:26849586-26849608 CCTTTTCTCGAGGAGCTGAAAGG + Intronic
928462176 2:31485267-31485289 CCAGGCCTGGAGGACCTGCTTGG + Intergenic
929998828 2:46847357-46847379 CCAGGGCTGGGGGAGGTGCAGGG - Intronic
932314593 2:70771391-70771413 CCATGTTTGGAAGATCTACATGG + Intergenic
932479902 2:72032875-72032897 CCACGTCAGGAGGAGCGGCTGGG - Intergenic
932644704 2:73488274-73488296 CAGTGTCTGGAGGGGCGGCAGGG + Intronic
934234514 2:90218423-90218445 CAATGACTGGAGGAACAGCAGGG + Intergenic
934582209 2:95452077-95452099 GCATGTCTGGAGGAGCTCTTGGG - Intergenic
934597241 2:95624637-95624659 GCATGTCTGGAGGAGCTCTTGGG + Intergenic
934842646 2:97638355-97638377 GCATGTCTGGAGGAGCTCTTGGG - Intergenic
935155512 2:100480611-100480633 ACTGGTCTGGAGGGGCTGCAGGG - Intronic
935880324 2:107558726-107558748 CCATGGCTGGAGGAGCCTCAGGG - Intergenic
936042199 2:109158507-109158529 CCTTGGCTGGGGGAGCTGGATGG + Intronic
936074634 2:109394009-109394031 CCATGGCTCCAGGAGCTGCGGGG + Intronic
937137477 2:119566557-119566579 TCATGTCTGTAGGAGCTGGGGGG - Intronic
938070036 2:128303552-128303574 CCATGTATGGAGGAGCATCTGGG - Intronic
942555168 2:177165348-177165370 CCATGGCTGCAGAAGCTGTAGGG + Intergenic
942932984 2:181518364-181518386 CCATGTCTGGAGGAGTTATGAGG + Intronic
943383409 2:187176261-187176283 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
945067006 2:205956052-205956074 CCAGGGCTGGATGAGCTGCTAGG - Intergenic
946145775 2:217729799-217729821 CCATGCCTGGACCAGCTCCAGGG + Intronic
948593691 2:239066517-239066539 CGATGGCTGGAAGAGGTGCAGGG - Intronic
948866710 2:240778810-240778832 CCATGGCGGGAGGAGCTGTTTGG - Intronic
1168750863 20:280027-280049 CCATGTCTGGAGGAGAAGCAGGG + Intronic
1169276013 20:4234197-4234219 CCAGGCCTGCAGGAGCTGCTGGG + Intronic
1169308963 20:4519055-4519077 CCATGTCTCTCTGAGCTGCAGGG - Intergenic
1169772143 20:9212994-9213016 CTATGACTAGAGGAGCAGCATGG - Intronic
1171282080 20:23909699-23909721 CCAGGCCTGGAGGACCTGCCTGG + Intergenic
1172210046 20:33191033-33191055 CCATCTCTGGGGCAGCTGAATGG + Intergenic
1172838454 20:37887799-37887821 CCAACTCTGGAGGAGATGCGAGG + Intergenic
1173720574 20:45254303-45254325 ACATGTCTGGCTGAGCTCCAAGG - Intronic
1174107369 20:48172139-48172161 CCCTGTCCAGAGGATCTGCAGGG - Intergenic
1174380175 20:50151214-50151236 CCAGGTCTGGAGGAGATAAAGGG + Intronic
1175599773 20:60263773-60263795 CCATTTCTGGAGGTGTTGCCAGG - Intergenic
1179051300 21:37890739-37890761 CCATGTCTGTGGGACTTGCAGGG - Intronic
1179406272 21:41128352-41128374 GCATGGTTGGAGGAGCTTCATGG + Intergenic
1180054069 21:45348056-45348078 CCAAGGCTGGAGGAAATGCAGGG + Intergenic
1180604384 22:17046072-17046094 TCGTGTCTGGTGAAGCTGCATGG + Intergenic
1181401712 22:22653705-22653727 CCAGGTCAGGAGGGGCTGGAGGG - Intergenic
1181703669 22:24634799-24634821 CCAGGTCAGGAGGGGCTGCGGGG - Intergenic
1181720993 22:24774375-24774397 TCATGGCTGGAGGAGGTGCATGG - Exonic
1182085831 22:27560567-27560589 CCAAGGCGGGAGGGGCTGCATGG + Intergenic
1182555006 22:31124460-31124482 CCGTGGCTGGGGGAGCTTCAGGG + Intronic
1184838704 22:47039892-47039914 CCATGGCTGGAGCAGGAGCAAGG + Intronic
1184932676 22:47692876-47692898 CCAGGTCTGGAGCAGAGGCAGGG - Intergenic
1185015594 22:48340874-48340896 CCCAGTCTGGGGAAGCTGCAAGG + Intergenic
1185137318 22:49080240-49080262 TCATTCCTGGGGGAGCTGCAGGG - Intergenic
1185328462 22:50239676-50239698 CCGTGTCTGGAGGAGTTGGGAGG - Intronic
1185375703 22:50481829-50481851 CCATGGCGGGCGGGGCTGCAGGG - Exonic
949949112 3:9214654-9214676 CCATGGATGGAGAAGCTGGAAGG + Intronic
952393250 3:32898937-32898959 CCATTTCTGAAGGAAGTGCAGGG + Intergenic
954224364 3:49172768-49172790 CCATGTCTGCAGGAGGTGGCCGG + Exonic
954364217 3:50137781-50137803 CCAGGGCTGGAGGAGCAGGAGGG - Intergenic
957503361 3:81086880-81086902 CCATATCTGGAGCATCAGCATGG + Intergenic
957741988 3:84282099-84282121 CCTTGTCTAGAGGTGCTGAAAGG - Intergenic
961564124 3:127751279-127751301 CCTTGCTGGGAGGAGCTGCAGGG - Intronic
961915383 3:130368864-130368886 CCATTTCTGGAGCATCTGGAAGG - Intronic
962646444 3:137445241-137445263 CCATGGCTGGAGCTGATGCAGGG + Intergenic
965480053 3:169207184-169207206 AAATGTCTGGAGAAGCAGCAGGG + Intronic
966176676 3:177145874-177145896 CCATGACAGGTGGAGTTGCAGGG + Intronic
966853170 3:184176815-184176837 GCATGTCTGGGAGGGCTGCAGGG + Intronic
967964010 3:194946290-194946312 CCATTTCCTGAGCAGCTGCAGGG - Intergenic
968662647 4:1805154-1805176 CCCTGTCTGGAGGGGCAGCAAGG + Intronic
969238935 4:5887370-5887392 CCATGTATGCAGGAGCAGCCCGG - Intronic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
971609888 4:28710142-28710164 GCAGGTCAGGAAGAGCTGCAGGG + Intergenic
974332179 4:60495380-60495402 CCATGACTGGAGGAACATCAGGG + Intergenic
978265873 4:106823454-106823476 CCATGGCTGGAGTGGCTGCAAGG + Intergenic
978480103 4:109179145-109179167 CAATGACAGGAGGAGCTTCAAGG + Intronic
981700268 4:147600242-147600264 ACATGTCTGAAGAAGCTGCAGGG - Intergenic
984862217 4:184251510-184251532 CCATGACTGGAGGAACACCAGGG + Intergenic
985177028 4:187213238-187213260 GAATGTCTGGAGTAGCAGCATGG - Intergenic
985231333 4:187821197-187821219 CAATGTCTGGTGGAGCTGTGGGG + Intergenic
985722584 5:1497536-1497558 CCACGTCTGGCGGGGCTTCAAGG + Intronic
985744418 5:1638120-1638142 CCCTGTCTGTGGGGGCTGCAGGG - Intergenic
987017539 5:13835878-13835900 CGATGACTGGAGGAACAGCAGGG - Intronic
987238841 5:15971956-15971978 CCATGTCTGCAGGAGCCCCGAGG - Intergenic
987431947 5:17845302-17845324 CCAGGTCTGAAGGACCTGCCTGG + Intergenic
987507958 5:18797945-18797967 CGATGACTGGAGGAACAGCAGGG + Intergenic
988076567 5:26362452-26362474 CCATGGCTGGAGTTGCTGCAGGG + Intergenic
988874259 5:35426630-35426652 CCATGTCTTGAGAATCTCCAAGG - Intergenic
992857471 5:80877614-80877636 CCATGCCAGAGGGAGCTGCAGGG + Intergenic
994131986 5:96240375-96240397 CCATGTTTGGTGAAGCTGCTGGG + Intergenic
994774504 5:104025960-104025982 CCATTTCAGGAGAGGCTGCAAGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997302928 5:132819683-132819705 CCATGTTAGGAGGAGCAGCGGGG + Intergenic
998768877 5:145519085-145519107 ACTTCTCTGGTGGAGCTGCATGG + Intronic
999052147 5:148534437-148534459 CCAGGCCTGGAGGACCTGCCTGG - Intronic
1001647966 5:173296274-173296296 CCCTGTGTGGATGAGCAGCATGG - Intergenic
1001756693 5:174175798-174175820 CCAGGCCTGGAGCTGCTGCAGGG - Intronic
1004899688 6:20182701-20182723 CCGTGGTTGGAGCAGCTGCACGG - Intronic
1005500506 6:26425178-26425200 CCAGGTATGAAAGAGCTGCATGG - Intergenic
1009242911 6:61201794-61201816 CCATCTCAGGAGATGCTGCAAGG - Intergenic
1011392327 6:86867731-86867753 CCAGGCCTGGAGGACCTGCCTGG - Intergenic
1012113133 6:95261361-95261383 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
1013005841 6:106072681-106072703 CCTTGTGTTGGGGAGCTGCAGGG + Intergenic
1014760502 6:125351534-125351556 CAATGTCTGGAGGAACACCATGG - Intergenic
1015197263 6:130537251-130537273 CCAGGCCTGGAGGACCTGCCTGG - Intergenic
1017161645 6:151371186-151371208 CAATGTCTGGAGGAGCAGATGGG - Intronic
1018243546 6:161801255-161801277 CAGTGACTGGAGGAGCAGCAGGG + Intronic
1019042681 6:169119694-169119716 CCATCTCAGGAGAGGCTGCAAGG + Intergenic
1021176969 7:17460508-17460530 CAATGACTGGAGGAGCCCCAGGG + Intergenic
1022453090 7:30533991-30534013 CCTTGTGTGGGAGAGCTGCAAGG - Intronic
1022505347 7:30906024-30906046 CCAGGTCGGGAGGAGCAGGATGG + Intergenic
1023126695 7:36961073-36961095 CAATGACTGGAGGAACTGCAGGG - Intronic
1024236312 7:47401763-47401785 CCACAGCTGGGGGAGCTGCAGGG + Intronic
1024550979 7:50562194-50562216 CCATGAGTGCAGGGGCTGCAGGG + Intronic
1025020627 7:55476723-55476745 CCATGGCTGGAGGAGCAGCTGGG - Intronic
1028262889 7:88686423-88686445 GCACCTCTGGGGGAGCTGCAAGG - Intergenic
1032917873 7:136511776-136511798 CCATCTCAGGAGACGCTGCAAGG - Intergenic
1034266303 7:149782735-149782757 CCATGTCAGGATGGGCTGCTGGG - Intergenic
1034658176 7:152745805-152745827 CCATGTCTGGTTGGGCTGTATGG + Intergenic
1035051302 7:156000448-156000470 CCATGCCTGGATGTCCTGCATGG + Intergenic
1035285572 7:157804465-157804487 CATTCTCTGGAGCAGCTGCATGG - Intronic
1035448818 7:158961405-158961427 CCTTTCCTGGAGGAGCTGCTTGG - Intergenic
1035559144 8:592134-592156 CCAGGTCTGGAGGAGATGCATGG + Intergenic
1036626937 8:10479984-10480006 CCATGCCTGGATCAGCTGCAGGG + Intergenic
1038885555 8:31659129-31659151 TCATGTCTGGAGAAGTTGCTTGG + Intronic
1039122190 8:34159482-34159504 CCATGTCTGCAGGTTCTGCATGG - Intergenic
1039552233 8:38451448-38451470 CCAGGGATGGAGGACCTGCAAGG + Intronic
1039600654 8:38834309-38834331 CCATGTTTTGAGAAGCTACAGGG - Intronic
1041421217 8:57668569-57668591 ACATGCCAGAAGGAGCTGCAGGG - Intergenic
1043982452 8:86657913-86657935 GCATGGCAGGGGGAGCTGCACGG - Intronic
1044008520 8:86964804-86964826 CCATCTCAGGAGAGGCTGCAAGG - Intronic
1044789949 8:95837117-95837139 CCATGCCTGTGGGCGCTGCATGG - Intergenic
1044886330 8:96782120-96782142 CAATGTCTAGTGAAGCTGCAGGG - Intronic
1044895230 8:96884663-96884685 CAATGTCTGGTGGAGATTCAAGG + Intronic
1045304636 8:100948886-100948908 CCATGACTGGATGTTCTGCAGGG + Exonic
1048649999 8:136465256-136465278 CCTTGTCTGGAGAAACTGCGTGG - Intergenic
1049474326 8:142789721-142789743 CCTGGGCTGGAGGAGCTGCCTGG + Intergenic
1052766978 9:32651091-32651113 CCATGCCTAGAGGACCTGCCTGG - Intergenic
1052999007 9:34567055-34567077 CCATCTTTGGAGCAGTTGCATGG - Intronic
1056127887 9:83554794-83554816 CCAGGCCTGGAGGACCTGCCTGG + Intergenic
1057692135 9:97294799-97294821 CCATGTCAGGAGGTACTGCCTGG + Intergenic
1057838845 9:98468889-98468911 ACAGGTCTAGAGGAGCAGCATGG + Intronic
1058137309 9:101321062-101321084 CCATGGCTGTTGGAGTTGCAAGG - Intronic
1059219584 9:112601547-112601569 CCATGTTCTGAGGATCTGCAAGG + Intronic
1059383622 9:113947544-113947566 ACATGGCTGTAGGAGCTGGAAGG - Intronic
1061304131 9:129722879-129722901 CCATTTCTGGGGGCCCTGCAGGG - Intergenic
1062168284 9:135119877-135119899 CCAGGTCTGCAGGGTCTGCAGGG - Exonic
1062376051 9:136262347-136262369 CGATGGCTGGTGGAGCTGCTGGG + Intergenic
1062442581 9:136577586-136577608 CCAGGGCCGGAGGAGCTGCGGGG + Intergenic
1185480584 X:443534-443556 CCGTGTGTGGAGCATCTGCAGGG - Intergenic
1187944817 X:24415887-24415909 CAATGCCTAGTGGAGCTGCAGGG + Intergenic
1188714990 X:33449511-33449533 CAAGGCCTGGAGGACCTGCATGG - Intergenic
1189079816 X:37959117-37959139 CAATGCCTAGTGGAGCTGCAGGG - Intronic
1190794483 X:53728289-53728311 GCATGTCTGGATGTGATGCAAGG - Intergenic
1193468486 X:81873489-81873511 CCATCTCAGGAGAGGCTGCAAGG - Intergenic
1193805188 X:85985875-85985897 CCAGGACTGGAGGACCTGCCTGG - Intronic
1195400379 X:104454995-104455017 CCCTTTCTGGAGGAACTGAAAGG + Intergenic
1195853742 X:109309085-109309107 CCATCTCAGGAGATGCTGCAAGG - Intergenic
1196152668 X:112392257-112392279 CCAGGCCTGGAGAACCTGCACGG + Intergenic
1196437721 X:115690028-115690050 CCTTTTCTGGAGGTGCTCCATGG + Intergenic
1197058367 X:122147817-122147839 CCATGCCTTGAGGAGCTGAGAGG - Intergenic
1199307026 X:146279163-146279185 CCAGGACTGGAGGACCTGCCTGG + Intergenic
1199879667 X:151963562-151963584 CCATGTCAGTAAGATCTGCATGG - Intronic
1201489235 Y:14523905-14523927 CCGAGTTTGGAGGAGCAGCACGG - Intronic
1202372849 Y:24210093-24210115 GCATGGCAGGGGGAGCTGCAGGG - Intergenic
1202497933 Y:25460027-25460049 GCATGGCAGGGGGAGCTGCAGGG + Intergenic